Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8209284.1

Orthogroup ID

OG0002688

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 574

Gene Structure 574 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8209284.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 574 bp

ggggagtcttagtgggcctcaggtgagggagatagcatttgggctggaaagggctgggtttcggttcttatgggcattgcgtgaaccgcccaagtccgctgtgtacctcccaagcgaccccgcaaacgtagacgaggtattgccacacgggtttttagaacggacatgcaaattgggcttggtgtgcgggtgggttccgcaagtgaagattctggcccaccaagcgatcggagggttcatatcgcattgcgggtggaactctattttggagagcttgtggtatggggtaccgattgccacttggccgatttacgcagaacaacaaatgaacgcgtttgagatggtgaaggaattgggattggcagtagagattaggctggactatagggagggaagtaatttggtgatggcggaggaggtggagagaagcataaagagcttgatggacggtgatcatgtggtgaggactagggtgaaggacatgagagagaagagtaggggagcattgatggaaaatgggtctgcatacaaagcactagaaggtttaattgaggagctaatgcccaagatttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

190

Amino Acids

21.27

Weight (kDa)

5.65

Isoelectric Point (pI)

35.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002688)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g02620 FvH4_2g02630 FvH4_3g12970 FvH4_3g12970 FvH4_3g17180 FvH4_3g17181
malus_domestica	MD05G1246700.v1.1
prunus_persica	Prupe.4G117900_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0153371 RchiOBHm_Chr5g0021081 RchiOBHm_Chr5g0021091 RchiOBHm_Chr5g0021101
rosa_laevigata	RLG00000032582 RLG00000032583 RLG00000032584 RLG00000032587
rosa_multiflora	Rmu_co7967648.1_g000001 Rmu_co8022450.1_g000001 Rmu_co8209284.1_g000001 Rmu_co8295101.1_g000001 Rmu_sc0002467.1_g000005 Rmu_sc0041861.1_g000001 Rmu_ssc0000244.1_g000020 Rmu_ssc0000244.1_g000027 Rmu_ssc0000244.1_g000028
rosa_roxburghii	Rroxscaffold_1G00057340 Rroxscaffold_1G00057380
rosa_rugosa	Rorug05G0064300 Rorug05G0064400 Rorug05G0064500 Rorug05G0064700
rosa_samantha	Rh2AG501400 Rh5CG166400 Rh5CG166500 Rh5CG166600 Rh5DG153100 Rh5DG153300 Rh5DG153400
rosa_wichuraiana	Rw5G013670 Rw5G013680

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	287
AccB1I	GGYRCC	1 cut(s)	287
AccI	GTMKAC	1 cut(s)	130
AccII	CGCG	1 cut(s)	333
AciI	CCGC	7 cut(s)	87, 97, 121, 187, 198, 250, 411
AcoI	YGGCCR	1 cut(s)	303
AfaI	GTAC	2 cut(s)	105, 289
AflIII	ACRYGT	1 cut(s)	331
AjuI	GAANNNNNNNTTGG	2 cut(s)	249, 281
AluBI	AGCT	3 cut(s)	274, 439, 557
AluI	AGCT	3 cut(s)	274, 439, 557
AoxI	GGCC	3 cut(s)	15, 214, 303
Asp718I	GGTACC	1 cut(s)	287
AspS9I	GGNCC	2 cut(s)	15, 215
AsuHPI	GGTGA	6 cut(s)	35, 356, 416, 462, 473, 485
AxyI	CCTNAGG	1 cut(s)	19
BanI	GGYRCC	1 cut(s)	287
BccI	CCATC	4 cut(s)	335, 401, 437, 503
BclI	TGATCA	1 cut(s)	452
BfaI	CTAG	2 cut(s)	469, 537
BfmI	CTRYAG	1 cut(s)	383
BmgT120I	GGNCC	2 cut(s)	15, 215
BmiI	GGNNCC	2 cut(s)	196, 289
BsaXI	ACNNNNNCTCC	3 cut(s)	26, 261, 291
Bse21I	CCTNAGG	1 cut(s)	19
Bse3DI	GCAATG	2 cut(s)	75, 245
BseMI	GCAATG	2 cut(s)	75, 245
BseMII	CTCAG	1 cut(s)	33
BseRI	GAGGAG	2 cut(s)	429, 567
BseYI	CCCAGC	1 cut(s)	54
Bsh1236I	CGCG	1 cut(s)	333
Bsh1285I	CGRYCG	1 cut(s)	229
BshFI	GGCC	3 cut(s)	17, 216, 305
BshNI	GGYRCC	1 cut(s)	287
BsiEI	CGRYCG	1 cut(s)	229
BsnI	GGCC	3 cut(s)	17, 216, 305
Bsp143I	GATC	2 cut(s)	226, 452
BspACI	CCGC	7 cut(s)	87, 97, 121, 187, 198, 250, 411
BspANI	GGCC	3 cut(s)	17, 216, 305
BspCNI	CTCAG	1 cut(s)	32
BspFNI	CGCG	1 cut(s)	333
BspLI	GGNNCC	2 cut(s)	196, 289
BspT107I	GGYRCC	1 cut(s)	287
BsrDI	GCAATG	2 cut(s)	75, 245
BssMI	GATC	2 cut(s)	226, 452
Bst4CI	ACNGT	1 cut(s)	450
Bst6I	CTCTTC	1 cut(s)	486
BstDEI	CTNAG	2 cut(s)	9, 19
BstFNI	CGCG	1 cut(s)	333
BstKTI	GATC	2 cut(s)	229, 455
BstMBI	GATC	2 cut(s)	226, 452
BstMCI	CGRYCG	1 cut(s)	229
BstMWI	GCNNNNNNNGC	6 cut(s)	86, 175, 184, 222, 436, 531
BstNSI	RCATGY	1 cut(s)	169
BstSFI	CTRYAG	1 cut(s)	383
BstUI	CGCG	1 cut(s)	333
Bsu36I	CCTNAGG	1 cut(s)	19
BsuRI	GGCC	3 cut(s)	17, 216, 305
Cfr13I	GGNCC	2 cut(s)	15, 215
Csp6I	GTAC	2 cut(s)	104, 288
CviAII	CATG	3 cut(s)	166, 456, 482
CviQI	GTAC	2 cut(s)	104, 288
DdeI	CTNAG	2 cut(s)	9, 19
DpnI	GATC	2 cut(s)	228, 454
DpnII	GATC	2 cut(s)	226, 452
EaeI	YGGCCR	1 cut(s)	303
Eam1104I	CTCTTC	1 cut(s)	486
EarI	CTCTTC	1 cut(s)	486
EciI	GGCGGA	1 cut(s)	426
Eco81I	CCTNAGG	1 cut(s)	19
FaeI	CATG	3 cut(s)	169, 459, 485
FaiI	YATR	9 cut(s)	71, 167, 240, 283, 385, 432, 457, 483, 527
FatI	CATG	3 cut(s)	165, 455, 481
FauI	CCCGC	3 cut(s)	128, 180, 243
FbaI	TGATCA	1 cut(s)	452
FblI	GTMKAC	1 cut(s)	130
FspBI	CTAG	2 cut(s)	469, 537
GsaI	CCCAGC	1 cut(s)	58
HaeIII	GGCC	3 cut(s)	17, 216, 305
Hin1II	CATG	3 cut(s)	169, 459, 485
HinfI	GANTC	2 cut(s)	5, 209
HphI	GGTGA	6 cut(s)	35, 356, 416, 462, 473, 485
Hpy166II	GTNNAC	3 cut(s)	84, 104, 131
Hpy188I	TCNGA	1 cut(s)	231
Hpy8I	GTNNAC	3 cut(s)	84, 104, 131
HpyAV	CCTTC	3 cut(s)	341, 470, 534
HpyCH4III	ACNGT	1 cut(s)	450
HpyCH4IV	ACGT	1 cut(s)	127
HpyCH4V	TGCA	2 cut(s)	169, 525
HpyF10VI	GCNNNNNNNGC	6 cut(s)	86, 175, 184, 222, 436, 531
HpyF3I	CTNAG	2 cut(s)	9, 19
HpySE526I	ACGT	1 cut(s)	127
Hsp92II	CATG	3 cut(s)	169, 459, 485
KpnI	GGTACC	1 cut(s)	291
Ksp22I	TGATCA	1 cut(s)	452
Kzo9I	GATC	2 cut(s)	226, 452
LmnI	GCTCC	2 cut(s)	501, 554
LpnPI	CCDG	5 cut(s)	6, 30, 40, 198, 363
MaeI	CTAG	2 cut(s)	469, 537
MaeII	ACGT	1 cut(s)	127
MalI	GATC	2 cut(s)	228, 454
MboI	GATC	2 cut(s)	226, 452
MboII	GAAGA	2 cut(s)	218, 503
MluCI	AATT	4 cut(s)	171, 351, 398, 547
MluI	ACGCGT	1 cut(s)	331
MlyI	GAGTC	1 cut(s)	14
MseI	TTAA	1 cut(s)	546
MspA1I	CMGCKG	1 cut(s)	99
MvnI	CGCG	1 cut(s)	333
MwoI	GCNNNNNNNGC	6 cut(s)	86, 175, 184, 222, 436, 531
NdeII	GATC	2 cut(s)	226, 452
NlaIII	CATG	3 cut(s)	169, 459, 485
NlaIV	GGNNCC	2 cut(s)	196, 289
NspI	RCATGY	1 cut(s)	169
PfeI	GAWTC	1 cut(s)	209
Ple19I	CGATCG	1 cut(s)	229
PleI	GAGTC	1 cut(s)	13
PpsI	GAGTC	1 cut(s)	13
PspFI	CCCAGC	1 cut(s)	54
PspN4I	GGNNCC	2 cut(s)	196, 289
PspPI	GGNCC	2 cut(s)	15, 215
PvuI	CGATCG	1 cut(s)	229
RsaI	GTAC	2 cut(s)	105, 289
RsaNI	GTAC	2 cut(s)	104, 288
SaqAI	TTAA	1 cut(s)	546
Sau3AI	GATC	2 cut(s)	226, 452
Sau96I	GGNCC	2 cut(s)	15, 215
SchI	GAGTC	1 cut(s)	14
SetI	ASST	9 cut(s)	25, 109, 130, 139, 276, 421, 441, 545, 559
SfcI	CTRYAG	1 cut(s)	383
Sse9I	AATT	4 cut(s)	171, 351, 398, 547
SsiI	CCGC	7 cut(s)	87, 97, 121, 187, 198, 250, 411
SspMI	CTAG	2 cut(s)	469, 537
TaaI	ACNGT	1 cut(s)	450
TaiI	ACGT	1 cut(s)	130
TasI	AATT	4 cut(s)	171, 351, 398, 547
TfiI	GAWTC	1 cut(s)	209
Tru1I	TTAA	1 cut(s)	546
Tru9I	TTAA	1 cut(s)	546
TspDTI	ATGAA	2 cut(s)	227, 342
TspGWI	ACGGA	1 cut(s)	176
XceI	RCATGY	1 cut(s)	169
XmiI	GTMKAC	1 cut(s)	130
XspI	CTAG	2 cut(s)	469, 537

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.