Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0041861.1

Orthogroup ID

OG0002688

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 573

Gene Structure 573 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0041861.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 219 bp

tggttcctgtgcttcgggagcatgggaagttttgctgagaatcaggtgaaagagatagagtgtgcgttggagcaaagtggatatcggttcttgtggtccctatgtcagcccccaccaaagggtaagatagctttccctagcgattacggagatgccaaggcagtctcgcctgaaggatttctcgatcggatggctaggatcggaaacactataggttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001101 GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0006066 GO:0006082 GO:0006629 GO:0006714 GO:0006720 GO:0006721 GO:0006950 GO:0006970 GO:0008150 GO:0008152 GO:0008194 GO:0008300 GO:0009056 GO:0009628 GO:0009651 GO:0009687 GO:0009719 GO:0009725 GO:0009737 GO:0009987 GO:0010033 GO:0016020 GO:0016042 GO:0016054 GO:0016107 GO:0016115 GO:0016740 GO:0016757 GO:0016758 GO:0019752 GO:0032787 GO:0033993 GO:0035251 GO:0042221 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043288 GO:0043290 GO:0043436 GO:0044237 GO:0044238 GO:0044242 GO:0044248 GO:0044255 GO:0044281 GO:0044282 GO:0044424 GO:0044444 GO:0044464 GO:0046164 GO:0046345 GO:0046395 GO:0046527 GO:0050896 GO:0071704 GO:0072329 GO:0080043 GO:0080044 GO:0080046 GO:0097305 GO:1901575 GO:1901615 GO:1901616 GO:1901700 GO:1902644

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

72

Amino Acids

7.97

Weight (kDa)

5.18

Isoelectric Point (pI)

45.22

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002688)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g02620 FvH4_2g02630 FvH4_3g12970 FvH4_3g12970 FvH4_3g17180 FvH4_3g17181
malus_domestica	MD05G1246700.v1.1
prunus_persica	Prupe.4G117900_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0153371 RchiOBHm_Chr5g0021081 RchiOBHm_Chr5g0021091 RchiOBHm_Chr5g0021101
rosa_laevigata	RLG00000032582 RLG00000032583 RLG00000032584 RLG00000032587
rosa_multiflora	Rmu_co7967648.1_g000001 Rmu_co8022450.1_g000001 Rmu_co8209284.1_g000001 Rmu_co8295101.1_g000001 Rmu_sc0002467.1_g000005 Rmu_sc0041861.1_g000001 Rmu_ssc0000244.1_g000020 Rmu_ssc0000244.1_g000027 Rmu_ssc0000244.1_g000028
rosa_roxburghii	Rroxscaffold_1G00057340 Rroxscaffold_1G00057380
rosa_rugosa	Rorug05G0064300 Rorug05G0064400 Rorug05G0064500 Rorug05G0064700
rosa_samantha	Rh2AG501400 Rh5CG166400 Rh5CG166500 Rh5CG166600 Rh5DG153100 Rh5DG153300 Rh5DG153400
rosa_wichuraiana	Rw5G013670 Rw5G013680

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	206
AcuI	CTGAAG	1 cut(s)	192
AfiI	CCNNNNNNNGG	2 cut(s)	118, 119
AluBI	AGCT	1 cut(s)	131
AluI	AGCT	1 cut(s)	131
Alw26I	GTCTC	1 cut(s)	169
AlwI	GGATC	1 cut(s)	206
Asp700I	GAANNNNTTC	1 cut(s)	177
AspS9I	GGNCC	1 cut(s)	96
AsuHPI	GGTGA	1 cut(s)	58
AvaII	GGWCC	1 cut(s)	96
BccI	CCATC	1 cut(s)	184
BcoDI	GTCTC	1 cut(s)	169
BfaI	CTAG	2 cut(s)	138, 195
BfmI	CTRYAG	1 cut(s)	210
Bme18I	GGWCC	1 cut(s)	96
BmgT120I	GGNCC	1 cut(s)	96
BmiI	GGNNCC	2 cut(s)	5, 98
BmsI	GCATC	1 cut(s)	142
BsaJI	CCNNGG	1 cut(s)	156
Bsc4I	CCNNNNNNNGG	2 cut(s)	118, 119
BseDI	CCNNGG	1 cut(s)	156
BseGI	GGATG	1 cut(s)	195
BseLI	CCNNNNNNNGG	2 cut(s)	118, 119
BseMII	CTCAG	1 cut(s)	27
Bsh1285I	CGRYCG	1 cut(s)	187
BsiEI	CGRYCG	1 cut(s)	187
BslFI	GGGAC	1 cut(s)	82
BslI	CCNNNNNNNGG	2 cut(s)	118, 119
BsmAI	GTCTC	1 cut(s)	169
BsmFI	GGGAC	1 cut(s)	82
Bsp143I	GATC	2 cut(s)	184, 198
BspCNI	CTCAG	1 cut(s)	28
BspLI	GGNNCC	2 cut(s)	5, 98
BspPI	GGATC	1 cut(s)	206
BssECI	CCNNGG	1 cut(s)	156
BssMI	GATC	2 cut(s)	184, 198
BssT1I	CCWWGG	1 cut(s)	156
BstDEI	CTNAG	1 cut(s)	36
BstF5I	GGATG	1 cut(s)	195
BstKTI	GATC	2 cut(s)	187, 201
BstMAI	GTCTC	1 cut(s)	169
BstMBI	GATC	2 cut(s)	184, 198
BstMCI	CGRYCG	1 cut(s)	187
BstMWI	GCNNNNNNNGC	1 cut(s)	18
BstSFI	CTRYAG	1 cut(s)	210
BtsCI	GGATG	1 cut(s)	195
Cfr13I	GGNCC	1 cut(s)	96
CviAII	CATG	1 cut(s)	22
CviJI	RGCY	3 cut(s)	109, 131, 194
CviKI_1	RGCY	3 cut(s)	109, 131, 194
DdeI	CTNAG	1 cut(s)	36
DpnI	GATC	2 cut(s)	186, 200
DpnII	GATC	2 cut(s)	184, 198
Eco130I	CCWWGG	1 cut(s)	156
Eco32I	GATATC	1 cut(s)	83
Eco47I	GGWCC	1 cut(s)	96
Eco57I	CTGAAG	1 cut(s)	192
EcoRV	GATATC	1 cut(s)	83
EcoT14I	CCWWGG	1 cut(s)	156
ErhI	CCWWGG	1 cut(s)	156
FaeI	CATG	1 cut(s)	25
FaiI	YATR	3 cut(s)	23, 103, 212
FaqI	GGGAC	1 cut(s)	82
FatI	CATG	1 cut(s)	21
FokI	GGATG	1 cut(s)	202
FspBI	CTAG	2 cut(s)	138, 195
Hin1II	CATG	1 cut(s)	25
HinfI	GANTC	1 cut(s)	40
HphI	GGTGA	1 cut(s)	58
Hpy188I	TCNGA	2 cut(s)	189, 203
Hpy188III	TCNNGA	2 cut(s)	16, 182
HpyAV	CCTTC	1 cut(s)	167
HpyF10VI	GCNNNNNNNGC	1 cut(s)	18
HpyF3I	CTNAG	1 cut(s)	36
Hsp92II	CATG	1 cut(s)	25
Kzo9I	GATC	2 cut(s)	184, 198
LmnI	GCTCC	2 cut(s)	18, 70
LpnPI	CCDG	3 cut(s)	20, 29, 183
LweI	GCATC	1 cut(s)	142
MaeI	CTAG	2 cut(s)	138, 195
MalI	GATC	2 cut(s)	186, 200
MboI	GATC	2 cut(s)	184, 198
MmeI	TCCRAC	1 cut(s)	48
MroXI	GAANNNNTTC	1 cut(s)	177
MwoI	GCNNNNNNNGC	1 cut(s)	18
NdeII	GATC	2 cut(s)	184, 198
NlaIII	CATG	1 cut(s)	25
NlaIV	GGNNCC	2 cut(s)	5, 98
PdmI	GAANNNNTTC	1 cut(s)	177
PfeI	GAWTC	1 cut(s)	40
Ple19I	CGATCG	1 cut(s)	187
PspN4I	GGNNCC	2 cut(s)	5, 98
PspPI	GGNCC	1 cut(s)	96
PvuI	CGATCG	1 cut(s)	187
Sau3AI	GATC	2 cut(s)	184, 198
Sau96I	GGNCC	1 cut(s)	96
SetI	ASST	3 cut(s)	48, 133, 217
SfaNI	GCATC	1 cut(s)	142
SfcI	CTRYAG	1 cut(s)	210
SinI	GGWCC	1 cut(s)	96
SspMI	CTAG	2 cut(s)	138, 195
StyI	CCWWGG	1 cut(s)	156
TaqI	TCGA	1 cut(s)	183
TfiI	GAWTC	1 cut(s)	40
TspGWI	ACGGA	1 cut(s)	162
VpaK11BI	GGWCC	1 cut(s)	96
XmnI	GAANNNNTTC	1 cut(s)	177
XspI	CTAG	2 cut(s)	138, 195

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.