RchiOBHm_Chr5g0030621

LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
24271987 .. 24272247
261 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 261 bp
ATGGGTTCGAACTCCAACTCAAAGCGTGGTGAAGATAGGATCAGTGGCTTACCCGACGCAATTCTTTGTCATATTCTTTCCTTCCTCTCCAAGGTTGATGTTGTGAGGACCAGCATTCTATGTCATCGATGGGAAAAGTTGTGGGTGTCTGTTCCCACTTTAGACCTACGTGATGACAGTTTTGATCAAGGGCGTGGCTCTACACCCATTCATAAATTCTCTCTTAGATGTACTAATATGGACGGACTATCCTCATATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

9.67

Weight (kDa)

7.77

Isoelectric Point (pI)

56.53

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 14 - 52 5.9e-09 F-box domain
F-box-like PF12937 14 - 47 5.2e-07 F-box-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 47
AcsI RAATTY 1 cut(s) 215
AfaI GTAC 1 cut(s) 232
AfiI CCNNNNNNNGG 1 cut(s) 91
AlwI GGATC 1 cut(s) 47
ApoI RAATTY 1 cut(s) 215
AspS9I GGNCC 1 cut(s) 108
AsuHPI GGTGA 1 cut(s) 41
AsuII TTCGAA 1 cut(s) 8
AvaII GGWCC 1 cut(s) 108
BccI CCATC 1 cut(s) 123
BclI TGATCA 1 cut(s) 184
Bme18I GGWCC 1 cut(s) 108
BmgT120I GGNCC 1 cut(s) 108
Bpu14I TTCGAA 1 cut(s) 8
Bsa29I ATCGAT 1 cut(s) 127
BsaAI YACGTR 1 cut(s) 170
BsaJI CCNNGG 1 cut(s) 90
Bsc4I CCNNNNNNNGG 1 cut(s) 91
BseCI ATCGAT 1 cut(s) 127
BseDI CCNNGG 1 cut(s) 90
BseLI CCNNNNNNNGG 1 cut(s) 91
BshVI ATCGAT 1 cut(s) 127
BslI CCNNNNNNNGG 1 cut(s) 91
BsmI GAATGC 1 cut(s) 114
Bsp119I TTCGAA 1 cut(s) 8
Bsp143I GATC 2 cut(s) 39, 184
BspDI ATCGAT 1 cut(s) 127
BspPI GGATC 1 cut(s) 47
BspT104I TTCGAA 1 cut(s) 8
BssECI CCNNGG 1 cut(s) 90
BssMI GATC 2 cut(s) 39, 184
BssT1I CCWWGG 1 cut(s) 90
Bst4CI ACNGT 1 cut(s) 179
BstBAI YACGTR 1 cut(s) 170
BstBI TTCGAA 1 cut(s) 8
BstDEI CTNAG 1 cut(s) 224
BstENI CCTNNNNNAGG 1 cut(s) 89
BstKTI GATC 2 cut(s) 42, 187
BstMBI GATC 2 cut(s) 39, 184
Bsu15I ATCGAT 1 cut(s) 127
BsuTUI ATCGAT 1 cut(s) 127
BtsIMutI CAGTG 1 cut(s) 49
Cfr13I GGNCC 1 cut(s) 108
ClaI ATCGAT 1 cut(s) 127
CseI GACGC 1 cut(s) 65
Csp6I GTAC 1 cut(s) 231
CviJI RGCY 2 cut(s) 48, 198
CviKI_1 RGCY 2 cut(s) 48, 198
CviQI GTAC 1 cut(s) 231
DdeI CTNAG 1 cut(s) 224
DpnI GATC 2 cut(s) 41, 186
DpnII GATC 2 cut(s) 39, 184
Eco130I CCWWGG 1 cut(s) 90
Eco47I GGWCC 1 cut(s) 108
EcoNI CCTNNNNNAGG 1 cut(s) 89
EcoT14I CCWWGG 1 cut(s) 90
ErhI CCWWGG 1 cut(s) 90
FaiI YATR 5 cut(s) 72, 121, 213, 239, 256
FbaI TGATCA 1 cut(s) 184
HgaI GACGC 1 cut(s) 65
HphI GGTGA 1 cut(s) 41
Hpy99I CGWCG 1 cut(s) 59
HpyAV CCTTC 1 cut(s) 91
HpyCH4III ACNGT 1 cut(s) 179
HpyCH4IV ACGT 1 cut(s) 169
HpyF3I CTNAG 1 cut(s) 224
HpySE526I ACGT 1 cut(s) 169
Ksp22I TGATCA 1 cut(s) 184
Kzo9I GATC 2 cut(s) 39, 184
LpnPI CCDG 1 cut(s) 124
MaeII ACGT 1 cut(s) 169
MalI GATC 2 cut(s) 41, 186
MboI GATC 2 cut(s) 39, 184
MboII GAAGA 1 cut(s) 44
MluCI AATT 2 cut(s) 60, 215
MmeI TCCRAC 1 cut(s) 39
MnlI CCTC 2 cut(s) 95, 99
Mva1269I GAATGC 1 cut(s) 114
NdeII GATC 2 cut(s) 39, 184
NspV TTCGAA 1 cut(s) 8
PctI GAATGC 1 cut(s) 114
Ppu21I YACGTR 1 cut(s) 170
PspPI GGNCC 1 cut(s) 108
RsaI GTAC 1 cut(s) 232
RsaNI GTAC 1 cut(s) 231
Sau3AI GATC 2 cut(s) 39, 184
Sau96I GGNCC 1 cut(s) 108
SetI ASST 3 cut(s) 96, 168, 172
SfuI TTCGAA 1 cut(s) 8
SgeI CNNG 7 cut(s) 38, 65, 103, 123, 182, 200, 206
SinI GGWCC 1 cut(s) 108
Sse9I AATT 2 cut(s) 60, 215
StyI CCWWGG 1 cut(s) 90
TaaI ACNGT 1 cut(s) 179
TaiI ACGT 1 cut(s) 172
TaqI TCGA 2 cut(s) 8, 127
TasI AATT 2 cut(s) 60, 215
TatI WGTACW 1 cut(s) 230
TscAI CASTG 1 cut(s) 49
TspDTI ATGAA 1 cut(s) 200
TspGWI ACGGA 1 cut(s) 258
TspRI CASTG 1 cut(s) 49
VpaK11BI GGWCC 1 cut(s) 108
XagI CCTNNNNNAGG 1 cut(s) 89
XapI RAATTY 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.