RchiOBHm_Chr4g0446551

Bifunctional dethiobiotin synthetase 7,8-diamino-pelargonic acid aminotransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
66682191 .. 66682699
509 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 138 bp
ATGTATAAGTTTCTGTATTGGGGAATGATGGACTACCTATATGCAAAGTGCACTCCTTGTATCATAGATTGTGTAATGGCAGAGCTTGAGAAGTTGGGTCAGAAATATCGTGTGGCTCTGAGATGTGAACTTGGTTAA

Protein Analysis

45

Amino Acids

5.36

Weight (kDa)

7.62

Isoelectric Point (pI)

20.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Fcf1 PF04900 11 - 41 1.4e-06 Fcf1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 85
AluI AGCT 1 cut(s) 85
Alw21I GWGCWC 1 cut(s) 53
Alw44I GTGCAC 1 cut(s) 49
ApaLI GTGCAC 1 cut(s) 49
BaeGI GKGCMC 1 cut(s) 53
Bbv12I GWGCWC 1 cut(s) 53
BccI CCATC 1 cut(s) 22
BpuEI CTTGAG 1 cut(s) 107
BseMII CTCAG 1 cut(s) 110
BseSI GKGCMC 1 cut(s) 53
BsiHKAI GWGCWC 1 cut(s) 53
Bsp1286I GDGCHC 1 cut(s) 53
BspCNI CTCAG 1 cut(s) 111
BstDEI CTNAG 1 cut(s) 119
BstSLI GKGCMC 1 cut(s) 53
CviJI RGCY 2 cut(s) 85, 116
CviKI_1 RGCY 2 cut(s) 85, 116
DdeI CTNAG 1 cut(s) 119
FaiI YATR 4 cut(s) 6, 40, 42, 65
Hpy166II GTNNAC 2 cut(s) 51, 128
Hpy188I TCNGA 2 cut(s) 102, 120
Hpy8I GTNNAC 2 cut(s) 51, 128
HpyCH4V TGCA 2 cut(s) 44, 51
HpyF3I CTNAG 1 cut(s) 119
MhlI GDGCHC 1 cut(s) 53
MseI TTAA 1 cut(s) 136
SaqAI TTAA 1 cut(s) 136
SduI GDGCHC 1 cut(s) 53
SetI ASST 2 cut(s) 39, 87
SgeI CNNG 3 cut(s) 69, 98, 122
SmlI CTYRAG 1 cut(s) 86
SmoI CTYRAG 1 cut(s) 86
Tru1I TTAA 1 cut(s) 136
Tru9I TTAA 1 cut(s) 136
VneI GTGCAC 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.