Rh4DG046100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
7559692 .. 7563548
3857 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG046100.1

Sequence Viewer

Length: 339 bp
ATGGCCTTGCAAGCTTCTTCTTCTCCATCCATCTCATCGGATATTCAGGCAAGAAAAGGGTATCTAGACGGGGTTGATGTTAACTATGAAGAAATAATTGAAGCCACTTCAATTGGCTTTAGTTCAATGATTTCCAAATTTGTTCGAATGGCACTCCTTGTATCACAGATTGTAATGGCAGAGCTTGAGAAGTTGGGTCAGAAATATCGTGTGGCTCTGGGGTATTTTCCTATGTTTTCTACAAATTGTTTTCATGACCAAAAGGGTTCAAAATTGAAAGTGTGTATGCAGTGTGTTGTATCCCTTTTCATTACTTTACTAAACCTTGAACGTTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

12.48

Weight (kDa)

7.69

Isoelectric Point (pI)

28.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 337
AclI AACGTT 1 cut(s) 331
AcsI RAATTY 1 cut(s) 137
AgsI TTSAA 6 cut(s) 101, 111, 126, 270, 277, 329
AluBI AGCT 2 cut(s) 14, 184
AluI AGCT 2 cut(s) 14, 184
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 137
AsuII TTCGAA 1 cut(s) 145
BccI CCATC 2 cut(s) 34, 38
BciVI GTATCC 1 cut(s) 310
BfaI CTAG 1 cut(s) 65
BfuI GTATCC 1 cut(s) 310
Bpu14I TTCGAA 1 cut(s) 145
BpuEI CTTGAG 1 cut(s) 206
BseGI GGATG 1 cut(s) 26
BshFI GGCC 1 cut(s) 5
BsnI GGCC 1 cut(s) 5
Bsp119I TTCGAA 1 cut(s) 145
BspANI GGCC 1 cut(s) 5
BspHI TCATGA 1 cut(s) 253
BspT104I TTCGAA 1 cut(s) 145
BstBI TTCGAA 1 cut(s) 145
BstC8I GCNNGC 1 cut(s) 12
BstF5I GGATG 1 cut(s) 26
BstMWI GCNNNNNNNGC 1 cut(s) 11
BsuI GTATCC 1 cut(s) 310
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 26
BtsI GCAGTG 1 cut(s) 296
BtsIMutI CAGTG 1 cut(s) 296
Cac8I GCNNGC 1 cut(s) 12
CciI TCATGA 1 cut(s) 253
CspCI CAANNNNNGTGG 2 cut(s) 94, 129
CviAII CATG 1 cut(s) 254
CviJI RGCY 6 cut(s) 5, 14, 104, 117, 184, 215
CviKI_1 RGCY 6 cut(s) 5, 14, 104, 117, 184, 215
FaeI CATG 1 cut(s) 257
FaiI YATR 5 cut(s) 87, 233, 255, 287, 337
FatI CATG 1 cut(s) 253
FokI GGATG 1 cut(s) 13
FspBI CTAG 1 cut(s) 65
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 1 cut(s) 257
HincII GTYRAC 1 cut(s) 82
HindII GTYRAC 1 cut(s) 82
HindIII AAGCTT 1 cut(s) 12
HpaI GTTAAC 1 cut(s) 82
Hpy166II GTNNAC 1 cut(s) 82
Hpy188I TCNGA 2 cut(s) 40, 201
Hpy188III TCNNGA 2 cut(s) 65, 254
Hpy8I GTNNAC 1 cut(s) 82
HpyCH4IV ACGT 1 cut(s) 331
HpyCH4V TGCA 2 cut(s) 10, 289
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
HpySE526I ACGT 1 cut(s) 331
Hsp92II CATG 1 cut(s) 257
KspAI GTTAAC 1 cut(s) 82
LpnPI CCDG 2 cut(s) 32, 203
MaeI CTAG 1 cut(s) 65
MaeII ACGT 1 cut(s) 331
MboII GAAGA 3 cut(s) 9, 12, 101
MfeI CAATTG 1 cut(s) 111
MluCI AATT 5 cut(s) 96, 111, 137, 244, 272
MseI TTAA 1 cut(s) 81
MunI CAATTG 1 cut(s) 111
MwoI GCNNNNNNNGC 1 cut(s) 11
NlaIII CATG 1 cut(s) 257
NspV TTCGAA 1 cut(s) 145
PagI TCATGA 1 cut(s) 253
PsiI TTATAA 1 cut(s) 337
Psp1406I AACGTT 1 cut(s) 331
SaqAI TTAA 1 cut(s) 81
SetI ASST 4 cut(s) 16, 186, 327, 334
SfuI TTCGAA 1 cut(s) 145
SmlI CTYRAG 1 cut(s) 185
SmoI CTYRAG 1 cut(s) 185
Sse9I AATT 5 cut(s) 96, 111, 137, 244, 272
SspMI CTAG 1 cut(s) 65
TaiI ACGT 1 cut(s) 334
TaqI TCGA 1 cut(s) 145
TasI AATT 5 cut(s) 96, 111, 137, 244, 272
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TscAI CASTG 1 cut(s) 296
TspDTI ATGAA 3 cut(s) 102, 242, 298
TspRI CASTG 1 cut(s) 296
XapI RAATTY 1 cut(s) 137
XbaI TCTAGA 1 cut(s) 64
XspI CTAG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.