RchiOBHm_Chr3g0464711

rRNA-processing protein FCF1 homolog

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
11729268 .. 11732507
3240 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ43093

Sequence Viewer

Length: 159 bp
ATGATGAACTGCCCATATGCAAAGTGCAATCCTGGTATCACAGATTATGTAATGGCAGAGCTTGAGAAGTTGGGTCAGAAATATCGTGTGGCTCTGAGGTTGTCCGTAACAAAAGAAGAGTTGCAGCTGTGGGATGAAGTCTTGATGTTTATATATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

52

Amino Acids

6.15

Weight (kDa)

5.14

Isoelectric Point (pI)

31.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 31
AluBI AGCT 2 cut(s) 61, 127
AluI AGCT 2 cut(s) 61, 127
ApeKI GCWGC 1 cut(s) 124
BbvI GCAGC 1 cut(s) 136
BciT130I CCWGG 1 cut(s) 33
BisI GCNGC 1 cut(s) 125
BlsI GCNGC 1 cut(s) 126
Bme1390I CCNGG 1 cut(s) 33
BmrFI CCNGG 1 cut(s) 33
BpuEI CTTGAG 1 cut(s) 83
BseBI CCWGG 1 cut(s) 33
BseGI GGATG 1 cut(s) 139
BseMII CTCAG 1 cut(s) 86
BseXI GCAGC 1 cut(s) 136
BspCNI CTCAG 1 cut(s) 87
Bst2UI CCWGG 1 cut(s) 33
Bst6I CTCTTC 1 cut(s) 111
BstDEI CTNAG 1 cut(s) 95
BstF5I GGATG 1 cut(s) 139
BstNI CCWGG 1 cut(s) 33
BstSCI CCNGG 1 cut(s) 31
BstV1I GCAGC 1 cut(s) 136
BtsCI GGATG 1 cut(s) 139
CviJI RGCY 3 cut(s) 61, 92, 127
CviKI_1 RGCY 3 cut(s) 61, 92, 127
DdeI CTNAG 1 cut(s) 95
Eam1104I CTCTTC 1 cut(s) 111
EarI CTCTTC 1 cut(s) 111
EcoRII CCWGG 1 cut(s) 31
FaiI YATR 5 cut(s) 16, 18, 48, 152, 154
FauNDI CATATG 1 cut(s) 16
Fnu4HI GCNGC 1 cut(s) 125
FokI GGATG 1 cut(s) 146
Fsp4HI GCNGC 1 cut(s) 125
GluI GCNGC 1 cut(s) 125
Hpy188I TCNGA 2 cut(s) 78, 96
Hpy188III TCNNGA 1 cut(s) 142
HpyCH4V TGCA 3 cut(s) 20, 27, 124
HpyF3I CTNAG 1 cut(s) 95
LpnPI CCDG 2 cut(s) 18, 45
Lsp1109I GCAGC 1 cut(s) 136
MaeIII GTNAC 1 cut(s) 106
MboII GAAGA 1 cut(s) 128
MnlI CCTC 1 cut(s) 90
MspA1I CMGCKG 1 cut(s) 127
MspR9I CCNGG 1 cut(s) 33
MvaI CCWGG 1 cut(s) 33
NdeI CATATG 1 cut(s) 16
PkrI GCNGC 1 cut(s) 126
Psp6I CCWGG 1 cut(s) 31
PspGI CCWGG 1 cut(s) 31
PvuII CAGCTG 1 cut(s) 127
SatI GCNGC 1 cut(s) 125
ScrFI CCNGG 1 cut(s) 33
SetI ASST 3 cut(s) 63, 101, 129
SgeI CNNG 5 cut(s) 44, 45, 74, 98, 154
SmlI CTYRAG 1 cut(s) 62
SmoI CTYRAG 1 cut(s) 62
StyD4I CCNGG 1 cut(s) 31
TseI GCWGC 1 cut(s) 124
TspDTI ATGAA 2 cut(s) 20, 150
TspGWI ACGGA 1 cut(s) 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.