RchiOBHm_Chr3g0473551

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0001542
Physical Location & Seq
Reverse (-)
19359270 .. 19361214
1945 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 315 bp
ATGGTCCAGGCAGGAGTGAAACCAAATGCAATAACATTTATCAGTCTTTTAACAGGTTGTAGCCATTTTGTATTGGTAGAGGAAGGTTTAAAGTACTTTTACTCTATGGAGAAAACATATGGCATAGTACCTAGAGCTGGACATTACTCTTGCATTATTGATTTACTTGGCAGGGCTGGAAGGCTTGAAGAGGCCGAAGATTTTATTAACAGCATGCCAATGCAGCCAAATGCTTTTGGGTGGTGCCCCTTTCTTGGTGCTTGCACGATTCATGGTGATAAAGAGGGGCATATATACTGGCAGCGGAGAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DYW_deaminase PPR PPR_2

Protein Analysis

104

Amino Acids

11.72

Weight (kDa)

6.39

Isoelectric Point (pI)

49.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 243
AciI CCGC 1 cut(s) 304
AfaI GTAC 2 cut(s) 95, 129
AfiI CCNNNNNNNGG 2 cut(s) 137, 254
AgsI TTSAA 1 cut(s) 188
AjnI CCWGG 1 cut(s) 6
AluBI AGCT 1 cut(s) 137
AluI AGCT 1 cut(s) 137
AoxI GGCC 1 cut(s) 192
ApeKI GCWGC 2 cut(s) 223, 301
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 287
AvaII GGWCC 1 cut(s) 4
BaeGI GKGCMC 1 cut(s) 248
BanI GGYRCC 1 cut(s) 243
BbvI GCAGC 1 cut(s) 235
BciT130I CCWGG 1 cut(s) 8
BfaI CTAG 1 cut(s) 132
BisI GCNGC 2 cut(s) 224, 302
BlsI GCNGC 2 cut(s) 225, 303
BmcAI AGTACT 1 cut(s) 95
Bme1390I CCNGG 1 cut(s) 8
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 245
BmrFI CCNGG 1 cut(s) 8
Bsc4I CCNNNNNNNGG 2 cut(s) 137, 254
Bse1I ACTGG 1 cut(s) 302
BseBI CCWGG 1 cut(s) 8
BseLI CCNNNNNNNGG 2 cut(s) 137, 254
BseNI ACTGG 1 cut(s) 302
BseSI GKGCMC 1 cut(s) 248
BseXI GCAGC 1 cut(s) 235
BshFI GGCC 1 cut(s) 194
BshNI GGYRCC 1 cut(s) 243
BslI CCNNNNNNNGG 2 cut(s) 137, 254
BsnI GGCC 1 cut(s) 194
Bsp1286I GDGCHC 1 cut(s) 248
BspACI CCGC 1 cut(s) 304
BspANI GGCC 1 cut(s) 194
BspLI GGNNCC 1 cut(s) 245
BspT107I GGYRCC 1 cut(s) 243
BsrI ACTGG 1 cut(s) 302
Bst2UI CCWGG 1 cut(s) 8
Bst6I CTCTTC 1 cut(s) 183
BstC8I GCNNGC 2 cut(s) 215, 262
BstMWI GCNNNNNNNGC 1 cut(s) 223
BstNI CCWGG 1 cut(s) 8
BstNSI RCATGY 1 cut(s) 217
BstSCI CCNGG 1 cut(s) 6
BstSLI GKGCMC 1 cut(s) 248
BstV1I GCAGC 1 cut(s) 235
BsuRI GGCC 1 cut(s) 194
Cac8I GCNNGC 2 cut(s) 215, 262
Cfr13I GGNCC 1 cut(s) 4
Csp6I GTAC 2 cut(s) 94, 128
CviAII CATG 2 cut(s) 214, 272
CviJI RGCY 6 cut(s) 63, 137, 176, 184, 194, 226
CviKI_1 RGCY 6 cut(s) 63, 137, 176, 184, 194, 226
CviQI GTAC 2 cut(s) 94, 128
DraI TTTAAA 1 cut(s) 90
Eam1104I CTCTTC 1 cut(s) 183
EarI CTCTTC 1 cut(s) 183
Eco47I GGWCC 1 cut(s) 4
EcoRII CCWGG 1 cut(s) 6
FaeI CATG 2 cut(s) 217, 275
FaiI YATR 9 cut(s) 107, 118, 120, 125, 215, 273, 291, 293, 295
FatI CATG 2 cut(s) 213, 271
FauNDI CATATG 1 cut(s) 118
Fnu4HI GCNGC 2 cut(s) 224, 302
Fsp4HI GCNGC 2 cut(s) 224, 302
FspBI CTAG 1 cut(s) 132
GluI GCNGC 2 cut(s) 224, 302
HaeIII GGCC 1 cut(s) 194
Hin1II CATG 2 cut(s) 217, 275
HinfI GANTC 1 cut(s) 268
HphI GGTGA 1 cut(s) 287
HpyAV CCTTC 2 cut(s) 77, 174
HpyCH4V TGCA 4 cut(s) 29, 153, 223, 264
HpyF10VI GCNNNNNNNGC 1 cut(s) 223
Hsp92II CATG 2 cut(s) 217, 275
LpnPI CCDG 6 cut(s) 20, 39, 123, 157, 162, 283
Lsp1109I GCAGC 1 cut(s) 235
MaeI CTAG 1 cut(s) 132
MboII GAAGA 2 cut(s) 200, 209
MhlI GDGCHC 1 cut(s) 248
MluCI AATT 1 cut(s) 310
MnlI CCTC 3 cut(s) 73, 184, 277
MseI TTAA 3 cut(s) 50, 89, 207
MslI CAYNNNNRTG 1 cut(s) 218
MspA1I CMGCKG 1 cut(s) 304
MspR9I CCNGG 1 cut(s) 8
MvaI CCWGG 1 cut(s) 8
MwoI GCNNNNNNNGC 1 cut(s) 223
NdeI CATATG 1 cut(s) 118
NlaIII CATG 2 cut(s) 217, 275
NlaIV GGNNCC 1 cut(s) 245
NspI RCATGY 1 cut(s) 217
PaeI GCATGC 1 cut(s) 217
PfeI GAWTC 1 cut(s) 268
PkrI GCNGC 2 cut(s) 225, 303
Psp6I CCWGG 1 cut(s) 6
PspGI CCWGG 1 cut(s) 6
PspN4I GGNNCC 1 cut(s) 245
PspPI GGNCC 1 cut(s) 4
RsaI GTAC 2 cut(s) 95, 129
RsaNI GTAC 2 cut(s) 94, 128
RseI CAYNNNNRTG 1 cut(s) 218
SaqAI TTAA 3 cut(s) 50, 89, 207
SatI GCNGC 2 cut(s) 224, 302
Sau96I GGNCC 1 cut(s) 4
ScaI AGTACT 1 cut(s) 95
ScrFI CCNGG 1 cut(s) 8
SduI GDGCHC 1 cut(s) 248
SetI ASST 4 cut(s) 58, 88, 133, 139
SinI GGWCC 1 cut(s) 4
SmiMI CAYNNNNRTG 1 cut(s) 218
SphI GCATGC 1 cut(s) 217
Sse9I AATT 1 cut(s) 310
SsiI CCGC 1 cut(s) 304
SspMI CTAG 1 cut(s) 132
StyD4I CCNGG 1 cut(s) 6
TasI AATT 1 cut(s) 310
TatI WGTACW 1 cut(s) 93
TfiI GAWTC 1 cut(s) 268
Tru1I TTAA 3 cut(s) 50, 89, 207
Tru9I TTAA 3 cut(s) 50, 89, 207
TseI GCWGC 2 cut(s) 223, 301
TspDTI ATGAA 1 cut(s) 260
VpaK11BI GGWCC 1 cut(s) 4
XceI RCATGY 1 cut(s) 217
XspI CTAG 1 cut(s) 132
ZrmI AGTACT 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.