Rh3DG207900

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
19126748 .. 19127041
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG207900.1

Sequence Viewer

Length: 294 bp
ATGATCAATGATGGGATTGGTGTAGATAAATATGTTGTTTATAGTGCATTGAGTGCTTGTTCTGCACTGAAGGCTTGTCAGTTTAGAAAATGTGTTCATTTGACAGTTGTGAAGTTGGGATTGCAAGTAGAGGTTGCTGTGGGAAATGCTCTGGTTGATATGTACTCGAAATCAGGTAATATGGAGAGTGCTTTAAATGTGTTTTGGGTTGACCTTGAGTGCAGAAATATTGTGTCGTGTTCCTCTCTGATCAATGGTTATGTTGAGATGGATGAAACCGAGAAGGCTTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.6

Weight (kDa)

4.94

Isoelectric Point (pI)

25.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 89
AfaI GTAC 1 cut(s) 164
BccI CCATC 2 cut(s) 5, 262
BclI TGATCA 2 cut(s) 3, 249
BpuEI CTTGAG 1 cut(s) 236
BseGI GGATG 1 cut(s) 277
BsgI GTGCAG 2 cut(s) 48, 241
Bsp143I GATC 2 cut(s) 3, 249
BssMI GATC 2 cut(s) 3, 249
Bst4CI ACNGT 1 cut(s) 106
BstAPI GCANNNNNTGC 1 cut(s) 53
BstF5I GGATG 1 cut(s) 277
BstKTI GATC 2 cut(s) 6, 252
BstMBI GATC 2 cut(s) 3, 249
BstMWI GCNNNNNNNGC 3 cut(s) 53, 62, 71
BtsCI GGATG 1 cut(s) 277
BtsIMutI CAGTG 1 cut(s) 65
Csp6I GTAC 1 cut(s) 163
CviJI RGCY 2 cut(s) 74, 287
CviKI_1 RGCY 2 cut(s) 74, 287
CviQI GTAC 1 cut(s) 163
DpnI GATC 2 cut(s) 5, 251
DpnII GATC 2 cut(s) 3, 249
DraI TTTAAA 1 cut(s) 195
Eco57I CTGAAG 1 cut(s) 89
FaiI YATR 5 cut(s) 33, 42, 161, 182, 261
FbaI TGATCA 2 cut(s) 3, 249
FokI GGATG 1 cut(s) 284
HincII GTYRAC 1 cut(s) 211
HindII GTYRAC 1 cut(s) 211
Hpy166II GTNNAC 1 cut(s) 211
Hpy188I TCNGA 1 cut(s) 249
Hpy8I GTNNAC 1 cut(s) 211
HpyAV CCTTC 2 cut(s) 64, 277
HpyCH4III ACNGT 1 cut(s) 106
HpyCH4V TGCA 4 cut(s) 47, 65, 124, 222
HpyF10VI GCNNNNNNNGC 3 cut(s) 53, 62, 71
Ksp22I TGATCA 2 cut(s) 3, 249
Kzo9I GATC 2 cut(s) 3, 249
LpnPI CCDG 2 cut(s) 137, 159
MalI GATC 2 cut(s) 5, 251
MboI GATC 2 cut(s) 3, 249
MnlI CCTC 2 cut(s) 124, 253
MseI TTAA 1 cut(s) 194
MwoI GCNNNNNNNGC 3 cut(s) 53, 62, 71
NdeII GATC 2 cut(s) 3, 249
RsaI GTAC 1 cut(s) 164
RsaNI GTAC 1 cut(s) 163
SaqAI TTAA 1 cut(s) 194
Sau3AI GATC 2 cut(s) 3, 249
SetI ASST 3 cut(s) 135, 178, 216
SgeI CNNG 8 cut(s) 69, 87, 137, 164, 178, 186, 227, 249
SmlI CTYRAG 1 cut(s) 215
SmoI CTYRAG 1 cut(s) 215
SspI AATATT 1 cut(s) 229
TaaI ACNGT 1 cut(s) 106
TaqI TCGA 1 cut(s) 167
TatI WGTACW 1 cut(s) 162
Tru1I TTAA 1 cut(s) 194
Tru9I TTAA 1 cut(s) 194
TscAI CASTG 1 cut(s) 72
TspDTI ATGAA 2 cut(s) 86, 288
TspRI CASTG 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.