Rmu_sc0010262.1_g000001

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010262.1
Physical Location & Seq
Reverse (-)
1691 .. 2068
378 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010262.1_g000001.1.cds

Sequence Viewer

Length: 378 bp
atgcctcaccgaaacttggtttcctggactgctatggtaactgggttctctcagaacttgaggttctcggagagtttcaaagccttttcccagatgagaagtgctggggagagccccacccagtttgcatttgcaagtgtcatcagagcttgtgtggttcttgggtcggttgagattgggaggcagctgcattctcttgctttgaaattgggcttggcttgtgagctgtttgtgggtagtagtttagcggatatttatttaacatatactaaagctcaatccactgttctactgtttatactgttgacaactgttcataagcgtgtgaaaagacagttttgccctttgtgttccatcaattacccactgccactctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

125

Amino Acids

13.87

Weight (kDa)

9.69

Isoelectric Point (pI)

49.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 248
AfiI CCNNNNNNNGG 1 cut(s) 16
AgsI TTSAA 2 cut(s) 79, 205
AjnI CCWGG 1 cut(s) 23
AjuI GAANNNNNNNTTGG 2 cut(s) 197, 229
AluBI AGCT 4 cut(s) 149, 187, 226, 275
AluI AGCT 4 cut(s) 149, 187, 226, 275
ApeKI GCWGC 2 cut(s) 184, 187
BanII GRGCYC 1 cut(s) 116
BbvI GCAGC 2 cut(s) 174, 196
BccI CCATC 1 cut(s) 362
BciT130I CCWGG 1 cut(s) 25
BisI GCNGC 2 cut(s) 185, 188
BlsI GCNGC 2 cut(s) 186, 189
Bme1390I CCNGG 1 cut(s) 25
BmrFI CCNGG 1 cut(s) 25
BmrI ACTGGG 2 cut(s) 51, 115
BmuI ACTGGG 2 cut(s) 51, 115
BpuEI CTTGAG 1 cut(s) 79
Bsc4I CCNNNNNNNGG 1 cut(s) 16
Bse1I ACTGG 2 cut(s) 46, 121
BseBI CCWGG 1 cut(s) 25
BseLI CCNNNNNNNGG 1 cut(s) 16
BseMII CTCAG 1 cut(s) 65
BseNI ACTGG 2 cut(s) 46, 121
BseXI GCAGC 2 cut(s) 174, 196
BseYI CCCAGC 1 cut(s) 104
BslI CCNNNNNNNGG 1 cut(s) 16
BsmI GAATGC 1 cut(s) 190
Bsp1286I GDGCHC 1 cut(s) 116
BspACI CCGC 1 cut(s) 248
BspCNI CTCAG 1 cut(s) 64
BsrI ACTGG 2 cut(s) 46, 121
Bst2UI CCWGG 1 cut(s) 25
Bst4CI ACNGT 5 cut(s) 286, 294, 303, 313, 336
BstDEI CTNAG 1 cut(s) 51
BstNI CCWGG 1 cut(s) 25
BstSCI CCNGG 1 cut(s) 23
BstV1I GCAGC 2 cut(s) 174, 196
BtsI GCAGTG 1 cut(s) 365
BtsIMutI CAGTG 2 cut(s) 282, 365
CspCI CAANNNNNGTGG 2 cut(s) 106, 141
CviJI RGCY 8 cut(s) 83, 114, 149, 187, 213, 218, 226, 275
CviKI_1 RGCY 8 cut(s) 83, 114, 149, 187, 213, 218, 226, 275
DdeI CTNAG 1 cut(s) 51
Eco24I GRGCYC 1 cut(s) 116
EcoRII CCWGG 1 cut(s) 23
EcoT38I GRGCYC 1 cut(s) 116
FaiI YATR 5 cut(s) 35, 265, 267, 299, 318
Fnu4HI GCNGC 2 cut(s) 185, 188
FriOI GRGCYC 1 cut(s) 116
Fsp4HI GCNGC 2 cut(s) 185, 188
GluI GCNGC 2 cut(s) 185, 188
GsaI CCCAGC 1 cut(s) 108
HincII GTYRAC 1 cut(s) 306
HindII GTYRAC 1 cut(s) 306
Hpy166II GTNNAC 1 cut(s) 306
Hpy188I TCNGA 4 cut(s) 54, 70, 146, 377
Hpy8I GTNNAC 1 cut(s) 306
HpyCH4III ACNGT 5 cut(s) 286, 294, 303, 313, 336
HpyCH4V TGCA 3 cut(s) 128, 134, 190
HpyF3I CTNAG 1 cut(s) 51
LpnPI CCDG 6 cut(s) 10, 27, 37, 90, 104, 134
Lsp1109I GCAGC 2 cut(s) 174, 196
MaeIII GTNAC 1 cut(s) 37
MhlI GDGCHC 1 cut(s) 116
MluCI AATT 2 cut(s) 206, 358
MnlI CCTC 3 cut(s) 15, 54, 174
MseI TTAA 1 cut(s) 260
MslI CAYNNNNRTG 1 cut(s) 321
MspA1I CMGCKG 1 cut(s) 187
MspR9I CCNGG 1 cut(s) 25
Mva1269I GAATGC 1 cut(s) 190
MvaI CCWGG 1 cut(s) 25
PctI GAATGC 1 cut(s) 190
PfoI TCCNGGA 1 cut(s) 23
PkrI GCNGC 2 cut(s) 186, 189
Psp6I CCWGG 1 cut(s) 23
PspFI CCCAGC 1 cut(s) 104
PspGI CCWGG 1 cut(s) 23
PvuII CAGCTG 1 cut(s) 187
RseI CAYNNNNRTG 1 cut(s) 321
SaqAI TTAA 1 cut(s) 260
SatI GCNGC 2 cut(s) 185, 188
ScrFI CCNGG 1 cut(s) 25
SduI GDGCHC 1 cut(s) 116
SetI ASST 5 cut(s) 65, 151, 189, 228, 277
SmiMI CAYNNNNRTG 1 cut(s) 321
SmlI CTYRAG 1 cut(s) 58
SmoI CTYRAG 1 cut(s) 58
Sse9I AATT 2 cut(s) 206, 358
SsiI CCGC 1 cut(s) 248
StyD4I CCNGG 1 cut(s) 23
TaaI ACNGT 5 cut(s) 286, 294, 303, 313, 336
TasI AATT 2 cut(s) 206, 358
Tru1I TTAA 1 cut(s) 260
Tru9I TTAA 1 cut(s) 260
TscAI CASTG 2 cut(s) 289, 372
TseI GCWGC 2 cut(s) 184, 187
TspDTI ATGAA 1 cut(s) 305
TspRI CASTG 2 cut(s) 289, 372
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.