Rh7BG406800

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0001542
Physical Location & Seq
Reverse (-)
45543164 .. 45543571
408 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG406800.1

Sequence Viewer

Length: 408 bp
ATGTATGGTAAATGTGGGTTACTTGATCATTCAATACAAGTGTTTGACGAGGTAGCCACCCCGACTGAAGTTGCATGGAATTCATTGCAAAGTGTATTTGCAGTTCATGGCTTAGGAAATGACGCCTTGAAAACTTTTAGTAGAATGGTCCAGGCAGGAGTGAAACCAAATGCAATAACATTTATCAGTCTTTTAACAGGTTGTAGCCATTCTGGATTGGTAGAGGAATGTTTAAAGTACTTTTACTCTATGGAGAAAGCATATGGAATAGTACCTAGAGCTAGACATTACTCTTGCATTATTGATTTACTTGGCCGAGCTGGAAGGCTTGAAGAGGCCGAAGATTTTATTAACAGCATGCGACTGCAGCCAAATACTTTTGGGTGGTGCTTGCACGATACATGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DYW_deaminase PPR PPR_2

Protein Analysis

135

Amino Acids

15.11

Weight (kDa)

5.9

Isoelectric Point (pI)

40.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 21 - 69 5.3e-10 PPR repeat family
PPR_long PF17177 40 - 115 2.7e-06 Pentacotripeptide-repeat region of PRORP
PPR_1 PF12854 89 - 121 7.1e-06 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 313
AcsI RAATTY 1 cut(s) 79
AcuI CTGAAG 1 cut(s) 87
AcyI GRCGYC 1 cut(s) 123
AfaI GTAC 2 cut(s) 239, 273
AgsI TTSAA 3 cut(s) 33, 130, 332
AjnI CCWGG 1 cut(s) 150
AluBI AGCT 2 cut(s) 281, 320
AluI AGCT 2 cut(s) 281, 320
AoxI GGCC 2 cut(s) 313, 336
ApeKI GCWGC 1 cut(s) 367
ApoI RAATTY 1 cut(s) 79
AspS9I GGNCC 1 cut(s) 148
AvaII GGWCC 1 cut(s) 148
BbvI GCAGC 1 cut(s) 379
BciT130I CCWGG 1 cut(s) 152
BclI TGATCA 1 cut(s) 25
BfaI CTAG 2 cut(s) 276, 282
BfmI CTRYAG 1 cut(s) 365
BisI GCNGC 1 cut(s) 368
BlsI GCNGC 1 cut(s) 369
BmcAI AGTACT 1 cut(s) 239
Bme1390I CCNGG 1 cut(s) 152
Bme18I GGWCC 1 cut(s) 148
BmgT120I GGNCC 1 cut(s) 148
BmrFI CCNGG 1 cut(s) 152
Bpu10I CCTNAGC 1 cut(s) 112
BsaHI GRCGYC 1 cut(s) 123
Bse3DI GCAATG 1 cut(s) 83
BseBI CCWGG 1 cut(s) 152
BseMI GCAATG 1 cut(s) 83
BseXI GCAGC 1 cut(s) 379
BshFI GGCC 2 cut(s) 315, 338
BsnI GGCC 2 cut(s) 315, 338
Bsp143I GATC 1 cut(s) 25
BspANI GGCC 2 cut(s) 315, 338
BspMAI CTGCAG 1 cut(s) 369
BsrDI GCAATG 1 cut(s) 83
BssMI GATC 1 cut(s) 25
BssNI GRCGYC 1 cut(s) 123
Bst2UI CCWGG 1 cut(s) 152
Bst6I CTCTTC 1 cut(s) 327
BstACI GRCGYC 1 cut(s) 123
BstC8I GCNNGC 2 cut(s) 359, 392
BstDEI CTNAG 1 cut(s) 112
BstKTI GATC 1 cut(s) 28
BstMBI GATC 1 cut(s) 25
BstMWI GCNNNNNNNGC 1 cut(s) 367
BstNI CCWGG 1 cut(s) 152
BstNSI RCATGY 1 cut(s) 361
BstSCI CCNGG 1 cut(s) 150
BstSFI CTRYAG 1 cut(s) 365
BstV1I GCAGC 1 cut(s) 379
BsuRI GGCC 2 cut(s) 315, 338
Cac8I GCNNGC 2 cut(s) 359, 392
Cfr13I GGNCC 1 cut(s) 148
CseI GACGC 1 cut(s) 131
Csp6I GTAC 2 cut(s) 238, 272
CviAII CATG 4 cut(s) 75, 107, 358, 402
CviJI RGCY 9 cut(s) 56, 111, 207, 281, 315, 320, 328, 338, 370
CviKI_1 RGCY 9 cut(s) 56, 111, 207, 281, 315, 320, 328, 338, 370
CviQI GTAC 2 cut(s) 238, 272
DdeI CTNAG 1 cut(s) 112
DpnI GATC 1 cut(s) 27
DpnII GATC 1 cut(s) 25
DraI TTTAAA 1 cut(s) 234
EaeI YGGCCR 1 cut(s) 313
Eam1104I CTCTTC 1 cut(s) 327
EarI CTCTTC 1 cut(s) 327
Eco47I GGWCC 1 cut(s) 148
Eco57I CTGAAG 1 cut(s) 87
EcoRI GAATTC 1 cut(s) 79
EcoRII CCWGG 1 cut(s) 150
FaeI CATG 4 cut(s) 78, 110, 361, 405
FaiI YATR 8 cut(s) 6, 76, 108, 251, 262, 264, 359, 403
FatI CATG 4 cut(s) 74, 106, 357, 401
FauNDI CATATG 1 cut(s) 262
FbaI TGATCA 1 cut(s) 25
Fnu4HI GCNGC 1 cut(s) 368
Fsp4HI GCNGC 1 cut(s) 368
FspBI CTAG 2 cut(s) 276, 282
GluI GCNGC 1 cut(s) 368
HaeIII GGCC 2 cut(s) 315, 338
HgaI GACGC 1 cut(s) 131
Hin1I GRCGYC 1 cut(s) 123
Hin1II CATG 4 cut(s) 78, 110, 361, 405
Hpy188III TCNNGA 1 cut(s) 213
HpyAV CCTTC 1 cut(s) 318
HpyCH4V TGCA 7 cut(s) 74, 88, 101, 173, 297, 367, 394
HpyF10VI GCNNNNNNNGC 1 cut(s) 367
HpyF3I CTNAG 1 cut(s) 112
Hsp92I GRCGYC 1 cut(s) 123
Hsp92II CATG 4 cut(s) 78, 110, 361, 405
Ksp22I TGATCA 1 cut(s) 25
Kzo9I GATC 1 cut(s) 25
LpnPI CCDG 6 cut(s) 137, 141, 164, 183, 198, 306
Lsp1109I GCAGC 1 cut(s) 379
MaeI CTAG 2 cut(s) 276, 282
MaeIII GTNAC 1 cut(s) 18
MalI GATC 1 cut(s) 27
MboI GATC 1 cut(s) 25
MboII GAAGA 2 cut(s) 344, 353
MluCI AATT 1 cut(s) 79
MnlI CCTC 3 cut(s) 43, 217, 328
MseI TTAA 3 cut(s) 194, 233, 351
MspR9I CCNGG 1 cut(s) 152
MvaI CCWGG 1 cut(s) 152
MwoI GCNNNNNNNGC 1 cut(s) 367
NdeI CATATG 1 cut(s) 262
NdeII GATC 1 cut(s) 25
NlaIII CATG 4 cut(s) 78, 110, 361, 405
NmeAIII GCCGAG 1 cut(s) 341
NspI RCATGY 1 cut(s) 361
PaeI GCATGC 1 cut(s) 361
PkrI GCNGC 1 cut(s) 369
Psp6I CCWGG 1 cut(s) 150
PspGI CCWGG 1 cut(s) 150
PspPI GGNCC 1 cut(s) 148
PsrI GAACNNNNNNTAC 2 cut(s) 87, 119
PstI CTGCAG 1 cut(s) 369
RsaI GTAC 2 cut(s) 239, 273
RsaNI GTAC 2 cut(s) 238, 272
SaqAI TTAA 3 cut(s) 194, 233, 351
SatI GCNGC 1 cut(s) 368
Sau3AI GATC 1 cut(s) 25
Sau96I GGNCC 1 cut(s) 148
ScaI AGTACT 1 cut(s) 239
ScrFI CCNGG 1 cut(s) 152
SetI ASST 5 cut(s) 54, 202, 277, 283, 322
SfcI CTRYAG 1 cut(s) 365
SinI GGWCC 1 cut(s) 148
SphI GCATGC 1 cut(s) 361
Sse9I AATT 1 cut(s) 79
SspMI CTAG 2 cut(s) 276, 282
StyD4I CCNGG 1 cut(s) 150
TasI AATT 1 cut(s) 79
TatI WGTACW 1 cut(s) 237
Tru1I TTAA 3 cut(s) 194, 233, 351
Tru9I TTAA 3 cut(s) 194, 233, 351
TseI GCWGC 1 cut(s) 367
TspDTI ATGAA 2 cut(s) 72, 95
VpaK11BI GGWCC 1 cut(s) 148
XapI RAATTY 1 cut(s) 79
XceI RCATGY 1 cut(s) 361
XspI CTAG 2 cut(s) 276, 282
ZrmI AGTACT 1 cut(s) 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.