RchiOBHm_Chr2g0164321

Kanadaptin

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
79479958 .. 79482461
2504 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 174 bp
ATGAAGAAAGAAATAGATGCTAGTTGTGCTAATGACATCTCTCAAGGTGGATTGACTCAAGGGCAACAAACTCAGATCTCTCGAAATGAAAAAAGAACAGAACAGTTAAAAAATTTCACCAGAACCTATATGCCAGCCCTTTTACTTCTTTATACTGATTCTGGAAGAGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.42

Weight (kDa)

8.98

Isoelectric Point (pI)

59.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 112
AluBI AGCT 1 cut(s) 170
AluI AGCT 1 cut(s) 170
ApoI RAATTY 1 cut(s) 112
AsuHPI GGTGA 1 cut(s) 109
BfaI CTAG 1 cut(s) 21
BglII AGATCT 1 cut(s) 75
BmsI GCATC 1 cut(s) 7
BpuEI CTTGAG 2 cut(s) 27, 42
BseMII CTCAG 1 cut(s) 86
Bsp143I GATC 1 cut(s) 75
BspCNI CTCAG 1 cut(s) 85
BspQI GCTCTTC 1 cut(s) 160
BssMI GATC 1 cut(s) 75
Bst4CI ACNGT 1 cut(s) 105
Bst6I CTCTTC 1 cut(s) 160
BstC8I GCNNGC 1 cut(s) 135
BstDEI CTNAG 1 cut(s) 72
BstKTI GATC 1 cut(s) 78
BstMBI GATC 1 cut(s) 75
BstMWI GCNNNNNNNGC 1 cut(s) 26
BstX2I RGATCY 1 cut(s) 75
BstYI RGATCY 1 cut(s) 75
Cac8I GCNNGC 1 cut(s) 135
CviJI RGCY 2 cut(s) 137, 170
CviKI_1 RGCY 2 cut(s) 137, 170
DdeI CTNAG 1 cut(s) 72
DpnI GATC 1 cut(s) 77
DpnII GATC 1 cut(s) 75
Eam1104I CTCTTC 1 cut(s) 160
EarI CTCTTC 1 cut(s) 160
FaiI YATR 3 cut(s) 129, 131, 153
FspBI CTAG 1 cut(s) 21
HinfI GANTC 2 cut(s) 55, 158
HphI GGTGA 1 cut(s) 109
Hpy188I TCNGA 1 cut(s) 75
Hpy188III TCNNGA 2 cut(s) 81, 162
HpyCH4III ACNGT 1 cut(s) 105
HpyF10VI GCNNNNNNNGC 1 cut(s) 26
HpyF3I CTNAG 1 cut(s) 72
Kzo9I GATC 1 cut(s) 75
LguI GCTCTTC 1 cut(s) 160
LpnPI CCDG 3 cut(s) 133, 147, 147
LweI GCATC 1 cut(s) 7
MaeI CTAG 1 cut(s) 21
MalI GATC 1 cut(s) 77
MboI GATC 1 cut(s) 75
MboII GAAGA 1 cut(s) 16
MflI RGATCY 1 cut(s) 75
MluCI AATT 1 cut(s) 112
MlyI GAGTC 1 cut(s) 49
MseI TTAA 1 cut(s) 107
MwoI GCNNNNNNNGC 1 cut(s) 26
NdeII GATC 1 cut(s) 75
PciSI GCTCTTC 1 cut(s) 160
PfeI GAWTC 1 cut(s) 158
PleI GAGTC 1 cut(s) 49
PpsI GAGTC 1 cut(s) 49
PsuI RGATCY 1 cut(s) 75
SapI GCTCTTC 1 cut(s) 160
SaqAI TTAA 1 cut(s) 107
Sau3AI GATC 1 cut(s) 75
SchI GAGTC 1 cut(s) 49
SetI ASST 3 cut(s) 49, 128, 172
SfaNI GCATC 1 cut(s) 7
SgeI CNNG 6 cut(s) 33, 56, 71, 93, 132, 146
SmlI CTYRAG 2 cut(s) 42, 57
SmoI CTYRAG 2 cut(s) 42, 57
Sse9I AATT 1 cut(s) 112
SspMI CTAG 1 cut(s) 21
TaaI ACNGT 1 cut(s) 105
TaqI TCGA 1 cut(s) 82
TasI AATT 1 cut(s) 112
TfiI GAWTC 1 cut(s) 158
Tru1I TTAA 1 cut(s) 107
Tru9I TTAA 1 cut(s) 107
TspDTI ATGAA 2 cut(s) 17, 102
XapI RAATTY 1 cut(s) 112
XspI CTAG 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.