RchiOBHm_Chr2g0164551

Histone-lysine N-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
79600320 .. 79602246
1927 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53259

Sequence Viewer

Length: 174 bp
ATGTCAGCTGTTGTTCGTGCTGTGCAACATATACCCAAAGGAGCTGAGGATCATTACGAGGATATCCAAGAAAGTGCAATTCTGGAAGGTTACGGATGCAAGGATTATATAATGACCAACAAATGCGATGGTTTTTTGCTTCGCGTCTCTGGTATGGAATTACCTGTGGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.34

Weight (kDa)

4.7

Isoelectric Point (pI)

53.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 144
AclWI GGATC 1 cut(s) 57
AluBI AGCT 2 cut(s) 8, 44
AluI AGCT 2 cut(s) 8, 44
Alw26I GTCTC 1 cut(s) 151
AlwI GGATC 1 cut(s) 57
BbvCI CCTCAGC 1 cut(s) 45
BccI CCATC 1 cut(s) 122
BcoDI GTCTC 1 cut(s) 151
BfaI CTAG 1 cut(s) 172
BmsI GCATC 1 cut(s) 86
Bpu10I CCTNAGC 1 cut(s) 45
BseGI GGATG 1 cut(s) 101
BseMII CTCAG 1 cut(s) 36
Bsh1236I CGCG 1 cut(s) 144
BsmAI GTCTC 1 cut(s) 151
BsmBI CGTCTC 1 cut(s) 151
Bsp143I GATC 1 cut(s) 49
BspCNI CTCAG 1 cut(s) 37
BspFNI CGCG 1 cut(s) 144
BspPI GGATC 1 cut(s) 57
BssMI GATC 1 cut(s) 49
BstDEI CTNAG 1 cut(s) 45
BstF5I GGATG 1 cut(s) 101
BstFNI CGCG 1 cut(s) 144
BstKTI GATC 1 cut(s) 52
BstMAI GTCTC 1 cut(s) 151
BstMBI GATC 1 cut(s) 49
BstUI CGCG 1 cut(s) 144
BtgZI GCGATG 1 cut(s) 141
BtsCI GGATG 1 cut(s) 101
CseI GACGC 1 cut(s) 133
CviJI RGCY 2 cut(s) 8, 44
CviKI_1 RGCY 2 cut(s) 8, 44
DdeI CTNAG 1 cut(s) 45
DpnI GATC 1 cut(s) 51
DpnII GATC 1 cut(s) 49
Eco32I GATATC 1 cut(s) 64
EcoRV GATATC 1 cut(s) 64
Esp3I CGTCTC 1 cut(s) 151
FaiI YATR 5 cut(s) 30, 32, 108, 110, 155
FokI GGATG 1 cut(s) 108
FspBI CTAG 1 cut(s) 172
HgaI GACGC 1 cut(s) 133
Hpy166II GTNNAC 1 cut(s) 169
Hpy188III TCNNGA 1 cut(s) 83
Hpy8I GTNNAC 1 cut(s) 169
HpyAV CCTTC 1 cut(s) 80
HpyCH4V TGCA 3 cut(s) 25, 77, 99
HpyF3I CTNAG 1 cut(s) 45
Kzo9I GATC 1 cut(s) 49
LmnI GCTCC 1 cut(s) 41
LpnPI CCDG 2 cut(s) 68, 135
LweI GCATC 1 cut(s) 86
MaeI CTAG 1 cut(s) 172
MaeIII GTNAC 1 cut(s) 89
MalI GATC 1 cut(s) 51
MboI GATC 1 cut(s) 49
MluCI AATT 2 cut(s) 78, 158
MnlI CCTC 2 cut(s) 40, 52
MspA1I CMGCKG 1 cut(s) 8
MvnI CGCG 1 cut(s) 144
NdeII GATC 1 cut(s) 49
PvuII CAGCTG 1 cut(s) 8
Sau3AI GATC 1 cut(s) 49
SetI ASST 4 cut(s) 10, 46, 91, 166
SfaNI GCATC 1 cut(s) 86
SgeI CNNG 7 cut(s) 29, 70, 80, 95, 112, 155, 162
Sse9I AATT 2 cut(s) 78, 158
SspMI CTAG 1 cut(s) 172
TasI AATT 2 cut(s) 78, 158
TspGWI ACGGA 1 cut(s) 108
XspI CTAG 1 cut(s) 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.