Rh2DG598400

Inner membrane component of T3SS, cytoplasmic domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
83053880 .. 83075617
21738 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG598400.1

Sequence Viewer

Length: 270 bp
ATGTCAACAGGAATGTCCTCAGATGAAGCATTGCATAAAGACATGCAGAAAAGTTTCACATTCTGCTTGCCGAATTCTGTTCTATTATTTGAGGGAATGTCAGCTGTTGTTCGTGCTGTGCAACATATACCCAAAGGAGCTGAGATTGCTCATATGAAGACAGAGATAGATGCTAGTCGTGGTAAAGACATCTCTCAACGTGAATTGACTCAAGGGCAACAAACTCAGATCGCTCGAAATGAACAAAGAACAGAACAGAAGCTTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

9.92

Weight (kDa)

6.83

Isoelectric Point (pI)

51.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 73
AluBI AGCT 3 cut(s) 104, 140, 262
AluI AGCT 3 cut(s) 104, 140, 262
ApoI RAATTY 1 cut(s) 73
Asp700I GAANNNNTTC 1 cut(s) 53
BbsI GAAGAC 1 cut(s) 164
BfaI CTAG 1 cut(s) 174
BmsI GCATC 1 cut(s) 160
BpiI GAAGAC 1 cut(s) 164
BpuEI CTTGAG 1 cut(s) 195
Bse3DI GCAATG 1 cut(s) 29
BseMI GCAATG 1 cut(s) 29
BseMII CTCAG 3 cut(s) 33, 132, 239
Bsp143I GATC 1 cut(s) 228
BspCNI CTCAG 3 cut(s) 32, 133, 238
BsrDI GCAATG 1 cut(s) 29
BssMI GATC 1 cut(s) 228
BstC8I GCNNGC 2 cut(s) 68, 264
BstDEI CTNAG 3 cut(s) 19, 141, 225
BstKTI GATC 1 cut(s) 231
BstMBI GATC 1 cut(s) 228
BstMWI GCNNNNNNNGC 1 cut(s) 146
BstNSI RCATGY 1 cut(s) 46
BstV2I GAAGAC 1 cut(s) 164
Cac8I GCNNGC 2 cut(s) 68, 264
CviAII CATG 1 cut(s) 43
CviJI RGCY 3 cut(s) 104, 140, 262
CviKI_1 RGCY 3 cut(s) 104, 140, 262
DdeI CTNAG 3 cut(s) 19, 141, 225
DpnI GATC 1 cut(s) 230
DpnII GATC 1 cut(s) 228
EcoRI GAATTC 1 cut(s) 73
FaeI CATG 1 cut(s) 46
FaiI YATR 6 cut(s) 36, 44, 126, 128, 153, 155
FatI CATG 1 cut(s) 42
FauNDI CATATG 1 cut(s) 153
FspBI CTAG 1 cut(s) 174
Hin1II CATG 1 cut(s) 46
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HindIII AAGCTT 1 cut(s) 260
HinfI GANTC 1 cut(s) 208
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 2 cut(s) 22, 228
Hpy8I GTNNAC 1 cut(s) 6
HpyCH4IV ACGT 1 cut(s) 199
HpyCH4V TGCA 3 cut(s) 34, 46, 121
HpyF10VI GCNNNNNNNGC 1 cut(s) 146
HpyF3I CTNAG 3 cut(s) 19, 141, 225
HpySE526I ACGT 1 cut(s) 199
Hsp92II CATG 1 cut(s) 46
Kzo9I GATC 1 cut(s) 228
LmnI GCTCC 1 cut(s) 137
LweI GCATC 1 cut(s) 160
MaeI CTAG 1 cut(s) 174
MaeII ACGT 1 cut(s) 199
MalI GATC 1 cut(s) 230
MboI GATC 1 cut(s) 228
MboII GAAGA 1 cut(s) 169
MluCI AATT 2 cut(s) 73, 203
MlyI GAGTC 1 cut(s) 202
MnlI CCTC 2 cut(s) 28, 85
MroXI GAANNNNTTC 1 cut(s) 53
MspA1I CMGCKG 1 cut(s) 104
MwoI GCNNNNNNNGC 1 cut(s) 146
NdeI CATATG 1 cut(s) 153
NdeII GATC 1 cut(s) 228
NlaIII CATG 1 cut(s) 46
NspI RCATGY 1 cut(s) 46
PdmI GAANNNNTTC 1 cut(s) 53
PleI GAGTC 1 cut(s) 202
PpsI GAGTC 1 cut(s) 202
PvuII CAGCTG 1 cut(s) 104
Sau3AI GATC 1 cut(s) 228
SchI GAGTC 1 cut(s) 202
SetI ASST 4 cut(s) 106, 142, 202, 264
SfaNI GCATC 1 cut(s) 160
SgeI CNNG 9 cut(s) 21, 55, 79, 125, 186, 191, 212, 224, 246
SmlI CTYRAG 1 cut(s) 210
SmoI CTYRAG 1 cut(s) 210
Sse9I AATT 2 cut(s) 73, 203
SspMI CTAG 1 cut(s) 174
TaiI ACGT 1 cut(s) 202
TaqI TCGA 1 cut(s) 235
TasI AATT 2 cut(s) 73, 203
TspDTI ATGAA 3 cut(s) 39, 170, 255
XapI RAATTY 1 cut(s) 73
XceI RCATGY 1 cut(s) 46
XmnI GAANNNNTTC 1 cut(s) 53
XspI CTAG 1 cut(s) 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.