RchiOBHm_Chr2g0144561

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
62137914 .. 62139864
1951 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51449

Sequence Viewer

Length: 135 bp
ATGTTCTTAACAACTCCTAGAAGGAATCGAGGCCTGAAATTGAGTTTTTTACGTCGAAAATCGAGCTCGCCGGTTTCTGGACATTTTCCGGCCACCTTCATACTGTTCAAGGTGATTGACGGTCTTCCTTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

44

Amino Acids

5.08

Weight (kDa)

12.0

Isoelectric Point (pI)

70.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 90
AfiI CCNNNNNNNGG 1 cut(s) 77
AgsI TTSAA 1 cut(s) 109
AluBI AGCT 1 cut(s) 66
AluI AGCT 1 cut(s) 66
Alw21I GWGCWC 1 cut(s) 68
AoxI GGCC 2 cut(s) 31, 90
AsuHPI GGTGA 1 cut(s) 124
BanII GRGCYC 1 cut(s) 68
BbsI GAAGAC 1 cut(s) 116
Bbv12I GWGCWC 1 cut(s) 68
BfaI CTAG 1 cut(s) 18
BpiI GAAGAC 1 cut(s) 116
BsaJI CCNNGG 1 cut(s) 128
Bsc4I CCNNNNNNNGG 1 cut(s) 77
Bse118I RCCGGY 1 cut(s) 70
BseDI CCNNGG 1 cut(s) 128
BseLI CCNNNNNNNGG 1 cut(s) 77
BshFI GGCC 2 cut(s) 33, 92
BsiHKAI GWGCWC 1 cut(s) 68
BsiSI CCGG 2 cut(s) 71, 89
BslI CCNNNNNNNGG 1 cut(s) 77
BsnI GGCC 2 cut(s) 33, 92
Bsp1286I GDGCHC 1 cut(s) 68
BspANI GGCC 2 cut(s) 33, 92
BsrFI RCCGGY 1 cut(s) 70
BssAI RCCGGY 1 cut(s) 70
BssECI CCNNGG 1 cut(s) 128
BssT1I CCWWGG 1 cut(s) 128
Bst4CI ACNGT 2 cut(s) 105, 122
BstC8I GCNNGC 1 cut(s) 68
BstV2I GAAGAC 1 cut(s) 116
BsuRI GGCC 2 cut(s) 33, 92
Cac8I GCNNGC 1 cut(s) 68
Cfr10I RCCGGY 1 cut(s) 70
CviJI RGCY 3 cut(s) 33, 66, 92
CviKI_1 RGCY 3 cut(s) 33, 66, 92
EaeI YGGCCR 1 cut(s) 90
Ecl136II GAGCTC 1 cut(s) 66
Eco130I CCWWGG 1 cut(s) 128
Eco147I AGGCCT 1 cut(s) 33
Eco24I GRGCYC 1 cut(s) 68
Eco53kI GAGCTC 1 cut(s) 66
EcoICRI GAGCTC 1 cut(s) 66
EcoT14I CCWWGG 1 cut(s) 128
EcoT38I GRGCYC 1 cut(s) 68
ErhI CCWWGG 1 cut(s) 128
FaiI YATR 1 cut(s) 101
FriOI GRGCYC 1 cut(s) 68
FspBI CTAG 1 cut(s) 18
HaeIII GGCC 2 cut(s) 33, 92
HapII CCGG 2 cut(s) 71, 89
HinfI GANTC 1 cut(s) 25
HpaII CCGG 2 cut(s) 71, 89
HphI GGTGA 1 cut(s) 124
Hpy188III TCNNGA 1 cut(s) 78
Hpy99I CGWCG 1 cut(s) 57
HpyAV CCTTC 2 cut(s) 15, 106
HpyCH4III ACNGT 2 cut(s) 105, 122
HpyCH4IV ACGT 1 cut(s) 52
HpySE526I ACGT 1 cut(s) 52
LpnPI CCDG 4 cut(s) 47, 63, 84, 102
MaeI CTAG 1 cut(s) 18
MaeII ACGT 1 cut(s) 52
MboII GAAGA 1 cut(s) 116
MhlI GDGCHC 1 cut(s) 68
MluCI AATT 1 cut(s) 38
MnlI CCTC 1 cut(s) 23
MseI TTAA 1 cut(s) 8
MspI CCGG 2 cut(s) 71, 89
PceI AGGCCT 1 cut(s) 33
PfeI GAWTC 1 cut(s) 25
Psp124BI GAGCTC 1 cut(s) 68
SacI GAGCTC 1 cut(s) 68
SaqAI TTAA 1 cut(s) 8
SduI GDGCHC 1 cut(s) 68
SetI ASST 4 cut(s) 55, 68, 98, 114
SgeI CNNG 9 cut(s) 30, 41, 46, 75, 79, 83, 90, 101, 121
Sse9I AATT 1 cut(s) 38
SseBI AGGCCT 1 cut(s) 33
SspMI CTAG 1 cut(s) 18
SstI GAGCTC 1 cut(s) 68
StuI AGGCCT 1 cut(s) 33
StyI CCWWGG 1 cut(s) 128
TaaI ACNGT 2 cut(s) 105, 122
TaiI ACGT 1 cut(s) 55
TaqI TCGA 3 cut(s) 28, 55, 62
TasI AATT 1 cut(s) 38
TfiI GAWTC 1 cut(s) 25
Tru1I TTAA 1 cut(s) 8
Tru9I TTAA 1 cut(s) 8
TspDTI ATGAA 1 cut(s) 88
XspI CTAG 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.