Rroxscaffold_2G00086530

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
8699100 .. 8701012
1913 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00086530.1

Sequence Viewer

Length: 240 bp
ATGACAAGCGAAGTTGGTTTCATATTAAAGGATCATTACGAGGATATCCAAGAAAGTGCAATTCTGGAAGGTTACCGATGCAAGGATAATGACCAACAAATGCGATGGTTTTTTGCTTCGCGTCTCTGGTATGGAATTACCTGTGGACTAGTCAGTGAGGAGAAAGTACATTGGTTGAGCATACCAGCATCAACAAAGGAAAAAGTATGCGATCTAAAGTTCCCAACACATTCATCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

9.23

Weight (kDa)

5.49

Isoelectric Point (pI)

49.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 121
AclWI GGATC 1 cut(s) 39
AfaI GTAC 1 cut(s) 168
AfiI CCNNNNNNNGG 1 cut(s) 82
AhlI ACTAGT 1 cut(s) 148
Alw26I GTCTC 1 cut(s) 128
AlwI GGATC 1 cut(s) 39
BccI CCATC 1 cut(s) 99
BcoDI GTCTC 1 cut(s) 128
BcuI ACTAGT 1 cut(s) 148
BfaI CTAG 1 cut(s) 149
BmsI GCATC 2 cut(s) 68, 197
Bsc4I CCNNNNNNNGG 1 cut(s) 82
BseLI CCNNNNNNNGG 1 cut(s) 82
BseRI GAGGAG 1 cut(s) 173
Bsh1236I CGCG 1 cut(s) 121
BslI CCNNNNNNNGG 1 cut(s) 82
BsmAI GTCTC 1 cut(s) 128
BsmBI CGTCTC 1 cut(s) 128
Bsp143I GATC 2 cut(s) 31, 211
BspFNI CGCG 1 cut(s) 121
BspPI GGATC 1 cut(s) 39
BssMI GATC 2 cut(s) 31, 211
BstEII GGTNACC 1 cut(s) 71
BstFNI CGCG 1 cut(s) 121
BstKTI GATC 2 cut(s) 34, 214
BstMAI GTCTC 1 cut(s) 128
BstMBI GATC 2 cut(s) 31, 211
BstPI GGTNACC 1 cut(s) 71
BstUI CGCG 1 cut(s) 121
BtgZI GCGATG 1 cut(s) 118
BtsIMutI CAGTG 1 cut(s) 160
CseI GACGC 1 cut(s) 110
Csp6I GTAC 1 cut(s) 167
CviQI GTAC 1 cut(s) 167
DpnI GATC 2 cut(s) 33, 213
DpnII GATC 2 cut(s) 31, 211
Eco32I GATATC 1 cut(s) 46
Eco91I GGTNACC 1 cut(s) 71
EcoO65I GGTNACC 1 cut(s) 71
EcoRV GATATC 1 cut(s) 46
Esp3I CGTCTC 1 cut(s) 128
FaiI YATR 5 cut(s) 23, 132, 182, 208, 238
FspBI CTAG 1 cut(s) 149
HgaI GACGC 1 cut(s) 110
Hpy166II GTNNAC 1 cut(s) 146
Hpy188III TCNNGA 1 cut(s) 65
Hpy8I GTNNAC 1 cut(s) 146
HpyAV CCTTC 1 cut(s) 62
HpyCH4V TGCA 2 cut(s) 59, 81
Kzo9I GATC 2 cut(s) 31, 211
LpnPI CCDG 4 cut(s) 50, 112, 154, 198
LweI GCATC 2 cut(s) 68, 197
MaeI CTAG 1 cut(s) 149
MaeIII GTNAC 1 cut(s) 71
MalI GATC 2 cut(s) 33, 213
MboI GATC 2 cut(s) 31, 211
MluCI AATT 2 cut(s) 60, 135
MnlI CCTC 2 cut(s) 34, 151
MseI TTAA 1 cut(s) 26
MvnI CGCG 1 cut(s) 121
NdeII GATC 2 cut(s) 31, 211
PspEI GGTNACC 1 cut(s) 71
RsaI GTAC 1 cut(s) 168
RsaNI GTAC 1 cut(s) 167
SaqAI TTAA 1 cut(s) 26
Sau3AI GATC 2 cut(s) 31, 211
SetI ASST 2 cut(s) 73, 143
SfaNI GCATC 2 cut(s) 68, 197
SpeI ACTAGT 1 cut(s) 148
Sse9I AATT 2 cut(s) 60, 135
SspMI CTAG 1 cut(s) 149
TasI AATT 2 cut(s) 60, 135
TatI WGTACW 1 cut(s) 166
Tru1I TTAA 1 cut(s) 26
Tru9I TTAA 1 cut(s) 26
TscAI CASTG 1 cut(s) 160
TspDTI ATGAA 2 cut(s) 10, 222
TspRI CASTG 1 cut(s) 160
XspI CTAG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.