RchiOBHm_Chr1g0345041

domain in FBox and BRCT domain containing plant proteins

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
37420551 .. 37422796
2246 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 162 bp
ATGGCTTCAAACTCAAAGCGTCTCAAATTATGCTCACATAATGAAGACAGGATCAGTGGGTTGCCAGATGCAATTCTTTGCCACATTCTCTCTTTCTTTTCAATCAGACAGGCTGTAAAGACTAGCATTTTATCACATAAATGGAGGAATGTCTGGGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

53

Amino Acids

6.08

Weight (kDa)

10.05

Isoelectric Point (pI)

56.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 18 - 52 1e-07 F-box domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 59
AgsI TTSAA 2 cut(s) 9, 102
Alw26I GTCTC 1 cut(s) 26
AlwI GGATC 1 cut(s) 59
BbsI GAAGAC 1 cut(s) 51
BcoDI GTCTC 1 cut(s) 26
BfaI CTAG 1 cut(s) 123
BmsI GCATC 1 cut(s) 58
BpiI GAAGAC 1 cut(s) 51
BsmAI GTCTC 1 cut(s) 26
BsmBI CGTCTC 1 cut(s) 26
Bsp143I GATC 1 cut(s) 51
BspPI GGATC 1 cut(s) 59
BssMI GATC 1 cut(s) 51
BstKTI GATC 1 cut(s) 54
BstMAI GTCTC 1 cut(s) 26
BstMBI GATC 1 cut(s) 51
BstV2I GAAGAC 1 cut(s) 51
BtsIMutI CAGTG 1 cut(s) 61
CseI GACGC 1 cut(s) 8
CviJI RGCY 3 cut(s) 5, 113, 158
CviKI_1 RGCY 3 cut(s) 5, 113, 158
DpnI GATC 1 cut(s) 53
DpnII GATC 1 cut(s) 51
Esp3I CGTCTC 1 cut(s) 26
FaiI YATR 3 cut(s) 31, 39, 138
FspBI CTAG 1 cut(s) 123
HgaI GACGC 1 cut(s) 8
Hpy188I TCNGA 1 cut(s) 107
HpyCH4V TGCA 1 cut(s) 71
Kzo9I GATC 1 cut(s) 51
LpnPI CCDG 4 cut(s) 34, 78, 95, 139
LweI GCATC 1 cut(s) 58
MaeI CTAG 1 cut(s) 123
MalI GATC 1 cut(s) 53
MboI GATC 1 cut(s) 51
MboII GAAGA 1 cut(s) 56
MluCI AATT 2 cut(s) 26, 72
MnlI CCTC 1 cut(s) 138
MseI TTAA 1 cut(s) 160
MslI CAYNNNNRTG 1 cut(s) 139
NdeII GATC 1 cut(s) 51
RseI CAYNNNNRTG 1 cut(s) 139
SaqAI TTAA 1 cut(s) 160
Sau3AI GATC 1 cut(s) 51
SfaNI GCATC 1 cut(s) 58
SgeI CNNG 4 cut(s) 61, 77, 122, 135
SmiMI CAYNNNNRTG 1 cut(s) 139
Sse9I AATT 2 cut(s) 26, 72
SspMI CTAG 1 cut(s) 123
TasI AATT 2 cut(s) 26, 72
Tru1I TTAA 1 cut(s) 160
Tru9I TTAA 1 cut(s) 160
TscAI CASTG 1 cut(s) 61
TspDTI ATGAA 1 cut(s) 57
TspRI CASTG 1 cut(s) 61
XspI CTAG 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.