RchiOBHm_Chr1g0318821

Sterol 3-beta-glucosyltransferase UGT80A2-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
6392739 .. 6393286
548 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ54907

Sequence Viewer

Length: 198 bp
ATGTTACTCAACTTTGCAGGAAATAGGGTTAGGCTAGCAACTCATGCAAATTTCAAAGATTTTGTCCTTACTGCTGGGTTGGAGTTCTTTCCTTTAGGTGGAGATCCAAAAGTTCTTGCCGAATGTTCTTATTTTCTTTTTAATGAAGGACAAGGTATTTACCAACTGTCTCGTTTGATCTATCAGACTTATTCATAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.37

Weight (kDa)

6.52

Isoelectric Point (pI)

12.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 98
AcsI RAATTY 1 cut(s) 49
AfiI CCNNNNNNNGG 1 cut(s) 98
AgsI TTSAA 1 cut(s) 55
Alw26I GTCTC 1 cut(s) 174
AlwI GGATC 1 cut(s) 98
ApoI RAATTY 1 cut(s) 49
ArsI GACNNNNNNTTYG 2 cut(s) 48, 80
AsuNHI GCTAGC 1 cut(s) 34
BcoDI GTCTC 1 cut(s) 174
BfaI CTAG 1 cut(s) 35
BmtI GCTAGC 1 cut(s) 38
Bsc4I CCNNNNNNNGG 1 cut(s) 98
BseLI CCNNNNNNNGG 1 cut(s) 98
BseYI CCCAGC 1 cut(s) 74
BslI CCNNNNNNNGG 1 cut(s) 98
BsmAI GTCTC 1 cut(s) 174
Bsp143I GATC 2 cut(s) 103, 177
BspOI GCTAGC 1 cut(s) 38
BspPI GGATC 1 cut(s) 98
BssMI GATC 2 cut(s) 103, 177
Bst4CI ACNGT 1 cut(s) 168
BstAPI GCANNNNNTGC 1 cut(s) 44
BstC8I GCNNGC 1 cut(s) 36
BstKTI GATC 2 cut(s) 106, 180
BstMAI GTCTC 1 cut(s) 174
BstMBI GATC 2 cut(s) 103, 177
BstMWI GCNNNNNNNGC 1 cut(s) 44
BstX2I RGATCY 1 cut(s) 103
BstYI RGATCY 1 cut(s) 103
Cac8I GCNNGC 1 cut(s) 36
CviAII CATG 1 cut(s) 44
CviJI RGCY 1 cut(s) 34
CviKI_1 RGCY 1 cut(s) 34
DpnI GATC 2 cut(s) 105, 179
DpnII GATC 2 cut(s) 103, 177
FaeI CATG 1 cut(s) 47
FaiI YATR 2 cut(s) 45, 196
FatI CATG 1 cut(s) 43
FspBI CTAG 1 cut(s) 35
GsaI CCCAGC 1 cut(s) 78
Hin1II CATG 1 cut(s) 47
Hpy188I TCNGA 1 cut(s) 186
HpyAV CCTTC 1 cut(s) 140
HpyCH4III ACNGT 1 cut(s) 168
HpyCH4V TGCA 2 cut(s) 17, 47
HpyF10VI GCNNNNNNNGC 1 cut(s) 44
Hsp92II CATG 1 cut(s) 47
Kzo9I GATC 2 cut(s) 103, 177
LpnPI CCDG 2 cut(s) 3, 60
MaeI CTAG 1 cut(s) 35
MaeIII GTNAC 1 cut(s) 3
MalI GATC 2 cut(s) 105, 179
MboI GATC 2 cut(s) 103, 177
MflI RGATCY 1 cut(s) 103
MluCI AATT 1 cut(s) 49
MmeI TCCRAC 1 cut(s) 60
MseI TTAA 1 cut(s) 141
MwoI GCNNNNNNNGC 1 cut(s) 44
NdeII GATC 2 cut(s) 103, 177
NheI GCTAGC 1 cut(s) 34
NlaIII CATG 1 cut(s) 47
PspFI CCCAGC 1 cut(s) 74
PsuI RGATCY 1 cut(s) 103
SaqAI TTAA 1 cut(s) 141
Sau3AI GATC 2 cut(s) 103, 177
SetI ASST 2 cut(s) 100, 157
SgeI CNNG 7 cut(s) 30, 47, 56, 87, 128, 164, 183
Sse9I AATT 1 cut(s) 49
SspMI CTAG 1 cut(s) 35
TaaI ACNGT 1 cut(s) 168
TasI AATT 1 cut(s) 49
Tru1I TTAA 1 cut(s) 141
Tru9I TTAA 1 cut(s) 141
TspDTI ATGAA 2 cut(s) 159, 183
XapI RAATTY 1 cut(s) 49
XspI CTAG 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.