Rmu_co8511089.1_g000002

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8511089.1
OG0003962
Physical Location & Seq
Reverse (-)
907 .. 1687
781 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8511089.1_g000002.1.cds

Sequence Viewer

Length: 324 bp
atgagccacgctcatgctaccgccagcgatactgactcctgccaaatgagtgacttgcaggaacacagccaagcaggctaccgcctgaaccccgacttacccctaaatcgccgcgccaagatagcatcagaagctccagaagctgggactaaaacatatcagtcccacatcgaaaacatggagaagatcatctctctcctcaactataaaagtcgcccaccggttcgggacctcgccgctatgtatgagttggcattagtggacctccacaaggcaaacaaggagagcaaacaggagcgcatagagaaagccgaggcccaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

12.03

Weight (kDa)

6.19

Isoelectric Point (pI)

66.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 143
AccII CGCG 1 cut(s) 114
AciI CCGC 4 cut(s) 21, 82, 112, 237
AfiI CCNNNNNNNGG 2 cut(s) 143, 271
AgeI ACCGGT 1 cut(s) 220
AluBI AGCT 2 cut(s) 134, 143
AluI AGCT 2 cut(s) 134, 143
AlwNI CAGNNNCTG 1 cut(s) 143
AoxI GGCC 1 cut(s) 315
AsiGI ACCGGT 1 cut(s) 220
AspLEI GCGC 2 cut(s) 116, 300
AspS9I GGNCC 3 cut(s) 229, 262, 316
AvaII GGWCC 2 cut(s) 229, 262
BglI GCCNNNNNGGC 1 cut(s) 75
BisI GCNGC 2 cut(s) 112, 237
BlsI GCNGC 2 cut(s) 113, 238
Bme18I GGWCC 2 cut(s) 229, 262
BmgT120I GGNCC 3 cut(s) 229, 262, 316
BmiI GGNNCC 1 cut(s) 230
BmsI GCATC 1 cut(s) 134
BplI GAGNNNNNCTC 1 cut(s) 27
BpmI CTGGAG 1 cut(s) 120
BsaJI CCNNGG 1 cut(s) 312
BsaWI WCCGGW 1 cut(s) 220
Bsc4I CCNNNNNNNGG 2 cut(s) 143, 271
Bse118I RCCGGY 1 cut(s) 220
BseDI CCNNGG 1 cut(s) 312
BseLI CCNNNNNNNGG 2 cut(s) 143, 271
BseRI GAGGAG 1 cut(s) 188
BseYI CCCAGC 1 cut(s) 143
Bsh1236I CGCG 1 cut(s) 114
BshFI GGCC 1 cut(s) 317
BshTI ACCGGT 1 cut(s) 220
BsiSI CCGG 1 cut(s) 221
BslFI GGGAC 3 cut(s) 148, 160, 242
BslI CCNNNNNNNGG 2 cut(s) 143, 271
BsmFI GGGAC 3 cut(s) 148, 160, 242
BsnI GGCC 1 cut(s) 317
Bsp143I GATC 1 cut(s) 186
BspACI CCGC 4 cut(s) 21, 82, 112, 237
BspANI GGCC 1 cut(s) 317
BspFNI CGCG 1 cut(s) 114
BspLI GGNNCC 1 cut(s) 230
BsrFI RCCGGY 1 cut(s) 220
BssAI RCCGGY 1 cut(s) 220
BssECI CCNNGG 1 cut(s) 312
BssMI GATC 1 cut(s) 186
BstC8I GCNNGC 2 cut(s) 25, 76
BstENI CCTNNNNNAGG 1 cut(s) 269
BstFNI CGCG 1 cut(s) 114
BstHHI GCGC 2 cut(s) 116, 300
BstKTI GATC 1 cut(s) 189
BstMBI GATC 1 cut(s) 186
BstMWI GCNNNNNNNGC 4 cut(s) 75, 122, 131, 140
BstUI CGCG 1 cut(s) 114
BsuRI GGCC 1 cut(s) 317
Cac8I GCNNGC 2 cut(s) 25, 76
CaiI CAGNNNCTG 1 cut(s) 143
CfoI GCGC 2 cut(s) 116, 300
Cfr10I RCCGGY 1 cut(s) 220
Cfr13I GGNCC 3 cut(s) 229, 262, 316
CspAI ACCGGT 1 cut(s) 220
CviAII CATG 2 cut(s) 14, 178
CviJI RGCY 7 cut(s) 6, 69, 78, 134, 143, 311, 317
CviKI_1 RGCY 7 cut(s) 6, 69, 78, 134, 143, 311, 317
DpnI GATC 1 cut(s) 188
DpnII GATC 1 cut(s) 186
Eco47I GGWCC 2 cut(s) 229, 262
EcoNI CCTNNNNNAGG 1 cut(s) 269
EcoO109I RGGNCCY 1 cut(s) 229
FaeI CATG 2 cut(s) 17, 181
FaiI YATR 7 cut(s) 15, 157, 179, 207, 242, 246, 302
FaqI GGGAC 3 cut(s) 148, 160, 242
FatI CATG 2 cut(s) 13, 177
Fnu4HI GCNGC 2 cut(s) 112, 237
Fsp4HI GCNGC 2 cut(s) 112, 237
GlaI GCGC 2 cut(s) 115, 299
GluI GCNGC 2 cut(s) 112, 237
GsaI CCCAGC 1 cut(s) 147
GsuI CTGGAG 1 cut(s) 120
HaeIII GGCC 1 cut(s) 317
HapII CCGG 1 cut(s) 221
HhaI GCGC 2 cut(s) 116, 300
Hin1II CATG 2 cut(s) 17, 181
Hin6I GCGC 2 cut(s) 114, 298
HinP1I GCGC 2 cut(s) 114, 298
HinfI GANTC 1 cut(s) 35
HpaII CCGG 1 cut(s) 221
Hpy166II GTNNAC 1 cut(s) 262
Hpy188I TCNGA 1 cut(s) 130
Hpy188III TCNNGA 2 cut(s) 137, 227
Hpy8I GTNNAC 1 cut(s) 262
HpyCH4V TGCA 1 cut(s) 58
HpyF10VI GCNNNNNNNGC 4 cut(s) 75, 122, 131, 140
Hsp92II CATG 2 cut(s) 17, 181
HspAI GCGC 2 cut(s) 114, 298
Kzo9I GATC 1 cut(s) 186
LmnI GCTCC 2 cut(s) 139, 295
LpnPI CCDG 9 cut(s) 37, 44, 52, 60, 98, 129, 150, 234, 278
LweI GCATC 1 cut(s) 134
MaeIII GTNAC 1 cut(s) 50
MalI GATC 1 cut(s) 188
MboI GATC 1 cut(s) 186
MboII GAAGA 1 cut(s) 196
MlyI GAGTC 1 cut(s) 29
MnlI CCTC 4 cut(s) 209, 242, 275, 307
MslI CAYNNNNRTG 1 cut(s) 12
MspI CCGG 1 cut(s) 221
MvnI CGCG 1 cut(s) 114
MwoI GCNNNNNNNGC 4 cut(s) 75, 122, 131, 140
NdeII GATC 1 cut(s) 186
NlaIII CATG 2 cut(s) 17, 181
NlaIV GGNNCC 1 cut(s) 230
NmuCI GTSAC 1 cut(s) 50
PflMI CCANNNNNTGG 1 cut(s) 143
PinAI ACCGGT 1 cut(s) 220
PkrI GCNGC 2 cut(s) 113, 238
PleI GAGTC 1 cut(s) 29
PpsI GAGTC 1 cut(s) 29
PpuMI RGGWCCY 1 cut(s) 229
Psp5II RGGWCCY 1 cut(s) 229
PspFI CCCAGC 1 cut(s) 143
PspN4I GGNNCC 1 cut(s) 230
PspPI GGNCC 3 cut(s) 229, 262, 316
PspPPI RGGWCCY 1 cut(s) 229
PstNI CAGNNNCTG 1 cut(s) 143
RseI CAYNNNNRTG 1 cut(s) 12
SatI GCNGC 2 cut(s) 112, 237
Sau3AI GATC 1 cut(s) 186
Sau96I GGNCC 3 cut(s) 229, 262, 316
SchI GAGTC 1 cut(s) 29
SetI ASST 4 cut(s) 136, 145, 234, 267
SfaNI GCATC 1 cut(s) 134
SinI GGWCC 2 cut(s) 229, 262
SmiMI CAYNNNNRTG 1 cut(s) 12
SsiI CCGC 4 cut(s) 21, 82, 112, 237
TaqI TCGA 1 cut(s) 171
TauI GCSGC 2 cut(s) 114, 239
TseFI GTSAC 1 cut(s) 50
Tsp45I GTSAC 1 cut(s) 50
Van91I CCANNNNNTGG 1 cut(s) 143
VpaK11BI GGWCC 2 cut(s) 229, 262
XagI CCTNNNNNAGG 1 cut(s) 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.