Rh5BG128100

Belongs to the universal ribosomal protein uL22 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
12216821 .. 12218199
1379 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG128100.1

Sequence Viewer

Length: 288 bp
ATGGGTTTCAATCTAGACATCGATCGAAATACTGGAGTTGAAACTAGGGTTCCATTTGTGGGTTCTTCGATTTGGGGATTTGGGGGTTTCTCGGCGATTCTTGCTGGTTTGCCTTATTTGCAGAGAATCTACAGCAGACCATCTTCTCCAACCATTCCAAGGCCTCTGCATCACTACTTTCAACAATTGGTAATTGCAATTCAAATCCTCTTAGTATTGTCGTTGCTATTCTCCCCCGCAGTTCCCGCCAAGTCCCGTCGCTCAATCTCTGAAATAGGGTTAGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

95

Amino Acids

10.42

Weight (kDa)

10.39

Isoelectric Point (pI)

71.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 237, 246
AfiI CCNNNNNNNGG 2 cut(s) 59, 159
AgsI TTSAA 4 cut(s) 10, 41, 182, 203
AoxI GGCC 1 cut(s) 161
BccI CCATC 1 cut(s) 148
BfaI CTAG 3 cut(s) 14, 45, 286
BfmI CTRYAG 1 cut(s) 130
BmiI GGNNCC 1 cut(s) 51
BmsI GCATC 1 cut(s) 178
BpmI CTGGAG 1 cut(s) 54
Bsa29I ATCGAT 1 cut(s) 21
BsaJI CCNNGG 1 cut(s) 158
Bsc4I CCNNNNNNNGG 2 cut(s) 59, 159
Bse1I ACTGG 1 cut(s) 37
BseCI ATCGAT 1 cut(s) 21
BseDI CCNNGG 1 cut(s) 158
BseLI CCNNNNNNNGG 2 cut(s) 59, 159
BseNI ACTGG 1 cut(s) 37
Bsh1285I CGRYCG 1 cut(s) 25
BshFI GGCC 1 cut(s) 163
BshVI ATCGAT 1 cut(s) 21
BsiEI CGRYCG 1 cut(s) 25
BslFI GGGAC 1 cut(s) 238
BslI CCNNNNNNNGG 2 cut(s) 59, 159
BsmFI GGGAC 1 cut(s) 238
BsnI GGCC 1 cut(s) 163
Bsp143I GATC 1 cut(s) 22
BspACI CCGC 2 cut(s) 237, 246
BspANI GGCC 1 cut(s) 163
BspDI ATCGAT 1 cut(s) 21
BspLI GGNNCC 1 cut(s) 51
BsrI ACTGG 1 cut(s) 37
BssECI CCNNGG 1 cut(s) 158
BssMI GATC 1 cut(s) 22
BssT1I CCWWGG 1 cut(s) 158
BstDEI CTNAG 1 cut(s) 211
BstKTI GATC 1 cut(s) 25
BstMBI GATC 1 cut(s) 22
BstMCI CGRYCG 1 cut(s) 25
BstMWI GCNNNNNNNGC 3 cut(s) 101, 118, 245
BstSFI CTRYAG 1 cut(s) 130
Bsu15I ATCGAT 1 cut(s) 21
BsuRI GGCC 1 cut(s) 163
BsuTUI ATCGAT 1 cut(s) 21
ClaI ATCGAT 1 cut(s) 21
CviJI RGCY 2 cut(s) 163, 285
CviKI_1 RGCY 2 cut(s) 163, 285
DdeI CTNAG 1 cut(s) 211
DpnI GATC 1 cut(s) 24
DpnII GATC 1 cut(s) 22
Eco130I CCWWGG 1 cut(s) 158
Eco147I AGGCCT 1 cut(s) 163
EcoT14I CCWWGG 1 cut(s) 158
ErhI CCWWGG 1 cut(s) 158
FaqI GGGAC 1 cut(s) 238
FauI CCCGC 2 cut(s) 244, 253
FspBI CTAG 3 cut(s) 14, 45, 286
GsuI CTGGAG 1 cut(s) 54
HaeIII GGCC 1 cut(s) 163
HinfI GANTC 2 cut(s) 97, 126
Hpy188I TCNGA 1 cut(s) 271
Hpy188III TCNNGA 1 cut(s) 14
Hpy99I CGWCG 1 cut(s) 261
HpyCH4V TGCA 3 cut(s) 121, 169, 197
HpyF10VI GCNNNNNNNGC 3 cut(s) 101, 118, 245
HpyF3I CTNAG 1 cut(s) 211
Kzo9I GATC 1 cut(s) 22
LpnPI CCDG 2 cut(s) 18, 90
LweI GCATC 1 cut(s) 178
MaeI CTAG 3 cut(s) 14, 45, 286
MalI GATC 1 cut(s) 24
MboI GATC 1 cut(s) 22
MboII GAAGA 2 cut(s) 57, 135
MfeI CAATTG 1 cut(s) 185
MluCI AATT 3 cut(s) 185, 192, 198
MmeI TCCRAC 1 cut(s) 173
MnlI CCTC 2 cut(s) 174, 218
MunI CAATTG 1 cut(s) 185
MwoI GCNNNNNNNGC 3 cut(s) 101, 118, 245
NdeII GATC 1 cut(s) 22
NlaIV GGNNCC 1 cut(s) 51
NmeAIII GCCGAG 1 cut(s) 71
PceI AGGCCT 1 cut(s) 163
PfeI GAWTC 2 cut(s) 97, 126
Ple19I CGATCG 1 cut(s) 25
PspN4I GGNNCC 1 cut(s) 51
PvuI CGATCG 1 cut(s) 25
Sau3AI GATC 1 cut(s) 22
SfaNI GCATC 1 cut(s) 178
SfcI CTRYAG 1 cut(s) 130
Sse9I AATT 3 cut(s) 185, 192, 198
SseBI AGGCCT 1 cut(s) 163
SsiI CCGC 2 cut(s) 237, 246
SspMI CTAG 3 cut(s) 14, 45, 286
StuI AGGCCT 1 cut(s) 163
StyI CCWWGG 1 cut(s) 158
TaqI TCGA 3 cut(s) 21, 25, 68
TasI AATT 3 cut(s) 185, 192, 198
TfiI GAWTC 2 cut(s) 97, 126
XbaI TCTAGA 1 cut(s) 13
XspI CTAG 3 cut(s) 14, 45, 286
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.