RchiOBHm_Chr7g0235071

Sterol 3-beta-glucosyltransferase UGT80A2-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0003962
Physical Location & Seq
Forward (+)
59753172 .. 59753467
296 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21068

Sequence Viewer

Length: 225 bp
ATGACTCTATGTTCGCCTACCAGTGAATACCCTCATCCTCTATCCTGTGTCAAGCAACATATTGGATATAGAGTGAGTCTCATATCAAACTTAAATATCTTACTGATTTTGATTTGCATTGGTGCTTTTGTTGGCCAGTTCTTTATTTTGTTGTTGAACAATTTTTTCTTTTCTTTTCAACTATCATATCAAATAGTTGATGCATTAATTTGGCTAGCAATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008194 GO:0016740 GO:0016757 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Glyco_transf_28 UDPGT

Protein Analysis

74

Amino Acids

8.42

Weight (kDa)

6.68

Isoelectric Point (pI)

34.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 133
AgsI TTSAA 2 cut(s) 157, 179
Alw26I GTCTC 1 cut(s) 83
AoxI GGCC 1 cut(s) 133
ArsI GACNNNNNNTTYG 1 cut(s) 27
AseI ATTAAT 1 cut(s) 206
AsuNHI GCTAGC 1 cut(s) 214
BalI TGGCCA 1 cut(s) 135
BcoDI GTCTC 1 cut(s) 83
BfaI CTAG 1 cut(s) 215
BmsI GCATC 1 cut(s) 190
BmtI GCTAGC 1 cut(s) 218
BplI GAGNNNNNCTC 2 cut(s) 63, 95
Bse1I ACTGG 2 cut(s) 21, 136
BseGI GGATG 1 cut(s) 34
BseNI ACTGG 2 cut(s) 21, 136
BshFI GGCC 1 cut(s) 135
BsmAI GTCTC 1 cut(s) 83
BsnI GGCC 1 cut(s) 135
BspANI GGCC 1 cut(s) 135
BspOI GCTAGC 1 cut(s) 218
BsrI ACTGG 2 cut(s) 21, 136
BstC8I GCNNGC 1 cut(s) 216
BstF5I GGATG 1 cut(s) 34
BstMAI GTCTC 1 cut(s) 83
BsuRI GGCC 1 cut(s) 135
BtsCI GGATG 1 cut(s) 34
BtsIMutI CAGTG 1 cut(s) 28
Cac8I GCNNGC 1 cut(s) 216
CviJI RGCY 2 cut(s) 135, 214
CviKI_1 RGCY 2 cut(s) 135, 214
EaeI YGGCCR 1 cut(s) 133
EcoT22I ATGCAT 1 cut(s) 205
FaiI YATR 5 cut(s) 10, 60, 69, 83, 187
FokI GGATG 1 cut(s) 21
FspBI CTAG 1 cut(s) 215
HaeIII GGCC 1 cut(s) 135
HinfI GANTC 2 cut(s) 4, 76
HpyCH4V TGCA 2 cut(s) 117, 203
LpnPI CCDG 3 cut(s) 34, 58, 149
LweI GCATC 1 cut(s) 190
MaeI CTAG 1 cut(s) 215
MlsI TGGCCA 1 cut(s) 135
MluCI AATT 3 cut(s) 160, 207, 219
MluNI TGGCCA 1 cut(s) 135
MlyI GAGTC 1 cut(s) 85
MnlI CCTC 2 cut(s) 42, 48
Mox20I TGGCCA 1 cut(s) 135
Mph1103I ATGCAT 1 cut(s) 205
MscI TGGCCA 1 cut(s) 135
MseI TTAA 2 cut(s) 92, 206
Msp20I TGGCCA 1 cut(s) 135
NheI GCTAGC 1 cut(s) 214
NsiI ATGCAT 1 cut(s) 205
PleI GAGTC 1 cut(s) 84
PpsI GAGTC 1 cut(s) 84
PshBI ATTAAT 1 cut(s) 206
SaqAI TTAA 2 cut(s) 92, 206
SchI GAGTC 1 cut(s) 85
SfaNI GCATC 1 cut(s) 190
SgeI CNNG 4 cut(s) 33, 57, 64, 148
Sse9I AATT 3 cut(s) 160, 207, 219
SspMI CTAG 1 cut(s) 215
TasI AATT 3 cut(s) 160, 207, 219
Tru1I TTAA 2 cut(s) 92, 206
Tru9I TTAA 2 cut(s) 92, 206
TscAI CASTG 1 cut(s) 28
TspRI CASTG 1 cut(s) 28
VspI ATTAAT 1 cut(s) 206
XspI CTAG 1 cut(s) 215
Zsp2I ATGCAT 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.