Rmu_sc0009346.1_g000011

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009346.1
OG0003962
Physical Location & Seq
Reverse (-)
29624 .. 30378
755 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009346.1_g000011.1.cds

Sequence Viewer

Length: 444 bp
atgagccacgctcacgctaccgtcaccgataccaactcccgccagcagagtgacctatggaaacacagccaatcaggctaccgcctgagccctggttcacccccaggtcaccgccgacgagccgtcacacaccaatcaagatggcatcagaagctgggaactgaagcatatcagtcccacctcgaaaacatagaagagatcagtctcttccctacctataaaaggggaaacgctgaaaagcaaacggatcaatgtgccaacccccatcccgccaaccccgcagctaacattaacccagcggttaacgttaaccgagcactatctatgtatgagctagcattagcggacctctacaaggcaaacagggagcgcaaacatgagcacagagagaaggccgaggcccaaaagcaagtggccaccaaatgtcaaaatttgacaaattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

147

Amino Acids

16.7

Weight (kDa)

9.51

Isoelectric Point (pI)

66.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 7 cut(s) 40, 82, 112, 270, 279, 299, 344
AclI AACGTT 1 cut(s) 306
AclWI GGATC 1 cut(s) 255
AcoI YGGCCR 1 cut(s) 414
AcsI RAATTY 1 cut(s) 430
AcuI CTGAAG 1 cut(s) 183
AfiI CCNNNNNNNGG 2 cut(s) 222, 355
AhdI GACNNNNNGTC 1 cut(s) 122
AjnI CCWGG 2 cut(s) 91, 103
AluBI AGCT 3 cut(s) 154, 284, 334
AluI AGCT 3 cut(s) 154, 284, 334
Alw21I GWGCWC 2 cut(s) 319, 384
Alw26I GTCTC 1 cut(s) 209
AlwI GGATC 1 cut(s) 255
AlwNI CAGNNNCTG 1 cut(s) 154
AoxI GGCC 3 cut(s) 393, 399, 414
ApeKI GCWGC 1 cut(s) 281
ApoI RAATTY 1 cut(s) 430
AspLEI GCGC 1 cut(s) 372
AspS9I GGNCC 2 cut(s) 346, 400
AsuHPI GGTGA 3 cut(s) 16, 90, 101
AsuNHI GCTAGC 1 cut(s) 334
AvaII GGWCC 1 cut(s) 346
BalI TGGCCA 1 cut(s) 416
BanII GRGCYC 1 cut(s) 92
Bbv12I GWGCWC 2 cut(s) 319, 384
BbvI GCAGC 1 cut(s) 293
BccI CCATC 2 cut(s) 135, 273
BceAI ACGGC 1 cut(s) 107
BciT130I CCWGG 2 cut(s) 93, 105
BcoDI GTCTC 1 cut(s) 209
BfaI CTAG 1 cut(s) 335
BglI GCCNNNNNGGC 1 cut(s) 75
BisI GCNGC 1 cut(s) 282
BlsI GCNGC 1 cut(s) 283
Bme1390I CCNGG 2 cut(s) 93, 105
Bme18I GGWCC 1 cut(s) 346
BmeRI GACNNNNNGTC 1 cut(s) 122
BmgT120I GGNCC 2 cut(s) 346, 400
BmrFI CCNGG 2 cut(s) 93, 105
BmsI GCATC 1 cut(s) 154
BmtI GCTAGC 1 cut(s) 338
BplI GAGNNNNNCTC 1 cut(s) 27
Bpu10I CCTNAGC 1 cut(s) 86
BsaJI CCNNGG 3 cut(s) 91, 103, 396
Bsc4I CCNNNNNNNGG 2 cut(s) 222, 355
BseBI CCWGG 2 cut(s) 93, 105
BseDI CCNNGG 3 cut(s) 91, 103, 396
BseGI GGATG 1 cut(s) 265
BseLI CCNNNNNNNGG 2 cut(s) 222, 355
BseMII CTCAG 1 cut(s) 77
BseXI GCAGC 1 cut(s) 293
BseYI CCCAGC 2 cut(s) 154, 295
BshFI GGCC 3 cut(s) 395, 401, 416
BsiHKAI GWGCWC 2 cut(s) 319, 384
BslFI GGGAC 1 cut(s) 160
BslI CCNNNNNNNGG 2 cut(s) 222, 355
BsmAI GTCTC 1 cut(s) 209
BsmFI GGGAC 1 cut(s) 160
BsnI GGCC 3 cut(s) 395, 401, 416
Bsp1286I GDGCHC 3 cut(s) 92, 319, 384
Bsp143I GATC 2 cut(s) 198, 247
BspACI CCGC 7 cut(s) 40, 82, 112, 270, 279, 299, 344
BspANI GGCC 3 cut(s) 395, 401, 416
BspCNI CTCAG 1 cut(s) 78
BspOI GCTAGC 1 cut(s) 338
BspPI GGATC 1 cut(s) 255
BssECI CCNNGG 3 cut(s) 91, 103, 396
BssMI GATC 2 cut(s) 198, 247
Bst2UI CCWGG 2 cut(s) 93, 105
Bst4CI ACNGT 1 cut(s) 22
Bst6I CTCTTC 2 cut(s) 189, 212
BstC8I GCNNGC 2 cut(s) 44, 336
BstDEI CTNAG 1 cut(s) 86
BstEII GGTNACC 1 cut(s) 107
BstENI CCTNNNNNAGG 2 cut(s) 220, 353
BstF5I GGATG 1 cut(s) 265
BstHHI GCGC 1 cut(s) 372
BstKTI GATC 2 cut(s) 201, 250
BstMAI GTCTC 1 cut(s) 209
BstMBI GATC 2 cut(s) 198, 247
BstMWI GCNNNNNNNGC 3 cut(s) 75, 151, 278
BstNI CCWGG 2 cut(s) 93, 105
BstPI GGTNACC 1 cut(s) 107
BstSCI CCNGG 2 cut(s) 91, 103
BstV1I GCAGC 1 cut(s) 293
BsuRI GGCC 3 cut(s) 395, 401, 416
BtsCI GGATG 1 cut(s) 265
Cac8I GCNNGC 2 cut(s) 44, 336
CaiI CAGNNNCTG 1 cut(s) 154
CfoI GCGC 1 cut(s) 372
Cfr13I GGNCC 2 cut(s) 346, 400
CviAII CATG 1 cut(s) 377
DdeI CTNAG 1 cut(s) 86
DpnI GATC 2 cut(s) 200, 249
DpnII GATC 2 cut(s) 198, 247
DriI GACNNNNNGTC 1 cut(s) 122
EaeI YGGCCR 1 cut(s) 414
Eam1104I CTCTTC 2 cut(s) 189, 212
Eam1105I GACNNNNNGTC 1 cut(s) 122
EarI CTCTTC 2 cut(s) 189, 212
Eco24I GRGCYC 1 cut(s) 92
Eco47I GGWCC 1 cut(s) 346
Eco57I CTGAAG 1 cut(s) 183
Eco91I GGTNACC 1 cut(s) 107
EcoNI CCTNNNNNAGG 2 cut(s) 220, 353
EcoO65I GGTNACC 1 cut(s) 107
EcoRII CCWGG 2 cut(s) 91, 103
EcoT38I GRGCYC 1 cut(s) 92
FaeI CATG 1 cut(s) 380
FaiI YATR 7 cut(s) 58, 169, 191, 219, 326, 330, 378
FaqI GGGAC 1 cut(s) 160
FatI CATG 1 cut(s) 376
FauI CCCGC 3 cut(s) 47, 277, 286
Fnu4HI GCNGC 1 cut(s) 282
FokI GGATG 1 cut(s) 252
FriOI GRGCYC 1 cut(s) 92
Fsp4HI GCNGC 1 cut(s) 282
FspBI CTAG 1 cut(s) 335
GlaI GCGC 1 cut(s) 371
GluI GCNGC 1 cut(s) 282
GsaI CCCAGC 2 cut(s) 158, 299
HaeIII GGCC 3 cut(s) 395, 401, 416
HhaI GCGC 1 cut(s) 372
Hin1II CATG 1 cut(s) 380
Hin6I GCGC 1 cut(s) 370
HinP1I GCGC 1 cut(s) 370
HincII GTYRAC 2 cut(s) 304, 310
HindII GTYRAC 2 cut(s) 304, 310
HpaI GTTAAC 2 cut(s) 304, 310
HphI GGTGA 3 cut(s) 16, 90, 101
Hpy166II GTNNAC 3 cut(s) 98, 304, 310
Hpy188I TCNGA 1 cut(s) 150
Hpy188III TCNNGA 1 cut(s) 138
Hpy8I GTNNAC 3 cut(s) 98, 304, 310
Hpy99I CGWCG 1 cut(s) 120
HpyAV CCTTC 1 cut(s) 385
HpyCH4III ACNGT 1 cut(s) 22
HpyCH4IV ACGT 1 cut(s) 306
HpyF10VI GCNNNNNNNGC 3 cut(s) 75, 151, 278
HpyF3I CTNAG 1 cut(s) 86
HpySE526I ACGT 1 cut(s) 306
Hsp92II CATG 1 cut(s) 380
HspAI GCGC 1 cut(s) 370
KspAI GTTAAC 2 cut(s) 304, 310
Kzo9I GATC 2 cut(s) 198, 247
LmnI GCTCC 1 cut(s) 367
Lsp1109I GCAGC 1 cut(s) 293
LweI GCATC 1 cut(s) 154
MaeI CTAG 1 cut(s) 335
MaeII ACGT 1 cut(s) 306
MaeIII GTNAC 4 cut(s) 22, 50, 107, 124
MalI GATC 2 cut(s) 200, 249
MboI GATC 2 cut(s) 198, 247
MboII GAAGA 2 cut(s) 199, 206
MhlI GDGCHC 3 cut(s) 92, 319, 384
MlsI TGGCCA 1 cut(s) 416
MluCI AATT 2 cut(s) 430, 439
MluNI TGGCCA 1 cut(s) 416
MnlI CCTC 3 cut(s) 191, 359, 391
Mox20I TGGCCA 1 cut(s) 416
MscI TGGCCA 1 cut(s) 416
MseI TTAA 4 cut(s) 291, 303, 309, 442
Msp20I TGGCCA 1 cut(s) 416
MspA1I CMGCKG 1 cut(s) 299
MspR9I CCNGG 2 cut(s) 93, 105
MvaI CCWGG 2 cut(s) 93, 105
MwoI GCNNNNNNNGC 3 cut(s) 75, 151, 278
NdeII GATC 2 cut(s) 198, 247
NheI GCTAGC 1 cut(s) 334
NlaIII CATG 1 cut(s) 380
NmeAIII GCCGAG 1 cut(s) 421
NmuCI GTSAC 4 cut(s) 22, 50, 107, 124
PkrI GCNGC 1 cut(s) 283
Psp1406I AACGTT 1 cut(s) 306
Psp6I CCWGG 2 cut(s) 91, 103
PspEI GGTNACC 1 cut(s) 107
PspFI CCCAGC 2 cut(s) 154, 295
PspGI CCWGG 2 cut(s) 91, 103
PspPI GGNCC 2 cut(s) 346, 400
PstNI CAGNNNCTG 1 cut(s) 154
SaqAI TTAA 4 cut(s) 291, 303, 309, 442
SatI GCNGC 1 cut(s) 282
Sau3AI GATC 2 cut(s) 198, 247
Sau96I GGNCC 2 cut(s) 346, 400
ScrFI CCNGG 2 cut(s) 93, 105
SduI GDGCHC 3 cut(s) 92, 319, 384
SetI ASST 9 cut(s) 57, 109, 156, 183, 218, 286, 309, 336, 351
SfaNI GCATC 1 cut(s) 154
SinI GGWCC 1 cut(s) 346
Sse9I AATT 2 cut(s) 430, 439
SsiI CCGC 7 cut(s) 40, 82, 112, 270, 279, 299, 344
SspMI CTAG 1 cut(s) 335
StyD4I CCNGG 2 cut(s) 91, 103
TaaI ACNGT 1 cut(s) 22
TaiI ACGT 1 cut(s) 309
TaqI TCGA 1 cut(s) 183
TasI AATT 2 cut(s) 430, 439
Tru1I TTAA 4 cut(s) 291, 303, 309, 442
Tru9I TTAA 4 cut(s) 291, 303, 309, 442
TseFI GTSAC 4 cut(s) 22, 50, 107, 124
TseI GCWGC 1 cut(s) 281
Tsp45I GTSAC 4 cut(s) 22, 50, 107, 124
TspGWI ACGGA 1 cut(s) 260
VpaK11BI GGWCC 1 cut(s) 346
XagI CCTNNNNNAGG 2 cut(s) 220, 353
XapI RAATTY 1 cut(s) 430
XspI CTAG 1 cut(s) 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.