RchiOBHm_Chr1g0345651

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
37961887 .. 37962926
1040 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ57197

Sequence Viewer

Length: 201 bp
ATGCCACCATGGCCTCCGATGGTGCTTCTCTGTTTAGACCCAGAGAATAGCTTGGAAAAGATCAAGCGCCAGCTTCCTTCTGGTTTGCGTCAGAACTTGCTCCAGAACCCACTTACCTTTTTCCTGATTAACTATAAATGGCTTCTCTACATTAGATTACTGAAATTGTTATTAATTTTGGAGCTTCTGGATTTTCAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.92

Weight (kDa)

8.98

Isoelectric Point (pI)

50.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 3 cut(s) 51, 73, 184
AluI AGCT 3 cut(s) 51, 73, 184
AoxI GGCC 1 cut(s) 11
AseI ATTAAT 1 cut(s) 173
AspLEI GCGC 1 cut(s) 69
BccI CCATC 1 cut(s) 13
BfoI RGCGCY 1 cut(s) 70
BglI GCCNNNNNGGC 1 cut(s) 10
BpmI CTGGAG 1 cut(s) 86
BsaJI CCNNGG 1 cut(s) 8
BseDI CCNNGG 1 cut(s) 8
BshFI GGCC 1 cut(s) 13
BsnI GGCC 1 cut(s) 13
Bsp143I GATC 1 cut(s) 60
Bsp19I CCATGG 1 cut(s) 8
BspANI GGCC 1 cut(s) 13
BssECI CCNNGG 1 cut(s) 8
BssMI GATC 1 cut(s) 60
BssT1I CCWWGG 1 cut(s) 8
BstC8I GCNNGC 1 cut(s) 71
BstDSI CCRYGG 1 cut(s) 8
BstH2I RGCGCY 1 cut(s) 70
BstHHI GCGC 1 cut(s) 69
BstKTI GATC 1 cut(s) 63
BstMBI GATC 1 cut(s) 60
BstMWI GCNNNNNNNGC 1 cut(s) 10
BsuRI GGCC 1 cut(s) 13
BtgI CCRYGG 1 cut(s) 8
Cac8I GCNNGC 1 cut(s) 71
CfoI GCGC 1 cut(s) 69
CseI GACGC 1 cut(s) 77
CviAII CATG 1 cut(s) 9
CviJI RGCY 5 cut(s) 13, 51, 73, 142, 184
CviKI_1 RGCY 5 cut(s) 13, 51, 73, 142, 184
DpnI GATC 1 cut(s) 62
DpnII GATC 1 cut(s) 60
Eco130I CCWWGG 1 cut(s) 8
EcoT14I CCWWGG 1 cut(s) 8
ErhI CCWWGG 1 cut(s) 8
FaeI CATG 1 cut(s) 12
FaiI YATR 2 cut(s) 10, 135
FatI CATG 1 cut(s) 8
GlaI GCGC 1 cut(s) 68
GsuI CTGGAG 1 cut(s) 86
HaeII RGCGCY 1 cut(s) 70
HaeIII GGCC 1 cut(s) 13
HgaI GACGC 1 cut(s) 77
HhaI GCGC 1 cut(s) 69
Hin1II CATG 1 cut(s) 12
Hin6I GCGC 1 cut(s) 67
HinP1I GCGC 1 cut(s) 67
Hpy188I TCNGA 2 cut(s) 18, 93
Hpy188III TCNNGA 3 cut(s) 103, 124, 188
HpyAV CCTTC 1 cut(s) 87
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
Hsp92II CATG 1 cut(s) 12
HspAI GCGC 1 cut(s) 67
Kzo9I GATC 1 cut(s) 60
LmnI GCTCC 2 cut(s) 105, 181
LpnPI CCDG 6 cut(s) 54, 66, 83, 116, 137, 173
MalI GATC 1 cut(s) 62
MboI GATC 1 cut(s) 60
MluCI AATT 2 cut(s) 164, 174
MnlI CCTC 1 cut(s) 24
MseI TTAA 2 cut(s) 129, 173
MwoI GCNNNNNNNGC 1 cut(s) 10
NcoI CCATGG 1 cut(s) 8
NdeII GATC 1 cut(s) 60
NlaIII CATG 1 cut(s) 12
PshBI ATTAAT 1 cut(s) 173
SaqAI TTAA 2 cut(s) 129, 173
Sau3AI GATC 1 cut(s) 60
SetI ASST 4 cut(s) 53, 75, 119, 186
SgeI CNNG 9 cut(s) 21, 53, 64, 76, 82, 93, 109, 115, 136
Sse9I AATT 2 cut(s) 164, 174
StyI CCWWGG 1 cut(s) 8
TasI AATT 2 cut(s) 164, 174
Tru1I TTAA 2 cut(s) 129, 173
Tru9I TTAA 2 cut(s) 129, 173
VspI ATTAAT 1 cut(s) 173
XcmI CCANNNNNNNNNTGG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.