RLG00000034027

Vacuolar protein sorting-associated protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Reverse (-)
35526518 .. 35527092
575 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000034027

Sequence Viewer

Length: 312 bp
ATGTTGACAAGCAATGGAAGGATTTGCTTCCATCAGAGTGGGTTCAGGTTTTTTAGATTTGGTACTAAAGTTGATAAACCAATGAATAAATTGACCAAGAAGCATACTAATGTATTGGGAGCCTTTTTTGGAAATACCAAGAATTCAAATCTACGACAAAAAAGAATTTGCTGGTACATGTATCTAGATGATGTGACTATCTGTTTGCCACAGGTTCATTTTATTTTGTCTTCATCAGACGGATATAGGGATGTACTGAAGTTAGCTGATAACTTTGGGTCATTATTGCCCACATATCTCTGCAAAATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

104

Amino Acids

11.93

Weight (kDa)

9.74

Isoelectric Point (pI)

23.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 142, 165
AcuI CTGAAG 1 cut(s) 278
AfaI GTAC 3 cut(s) 64, 176, 255
AflIII ACRYGT 1 cut(s) 177
AgsI TTSAA 1 cut(s) 147
AluBI AGCT 1 cut(s) 266
AluI AGCT 1 cut(s) 266
ApoI RAATTY 2 cut(s) 142, 165
ArsI GACNNNNNNTTYG 2 cut(s) 187, 219
BaeI ACNNNNGTAYC 2 cut(s) 54, 87
BbsI GAAGAC 1 cut(s) 222
BccI CCATC 1 cut(s) 39
BfaI CTAG 1 cut(s) 185
BmiI GGNNCC 1 cut(s) 121
BpiI GAAGAC 1 cut(s) 222
Bse3DI GCAATG 1 cut(s) 19
BseGI GGATG 1 cut(s) 256
BseMI GCAATG 1 cut(s) 19
BspLI GGNNCC 1 cut(s) 121
BsrDI GCAATG 1 cut(s) 19
BstF5I GGATG 1 cut(s) 256
BstNSI RCATGY 1 cut(s) 181
BstV2I GAAGAC 1 cut(s) 222
BstXI CCANNNNNNTGG 1 cut(s) 38
BtsCI GGATG 1 cut(s) 256
Csp6I GTAC 3 cut(s) 63, 175, 254
CviAII CATG 1 cut(s) 178
CviJI RGCY 2 cut(s) 122, 266
CviKI_1 RGCY 2 cut(s) 122, 266
CviQI GTAC 3 cut(s) 63, 175, 254
Eco57I CTGAAG 1 cut(s) 278
EcoRI GAATTC 1 cut(s) 142
FaeI CATG 1 cut(s) 181
FaiI YATR 4 cut(s) 105, 179, 246, 295
FatI CATG 1 cut(s) 177
FokI GGATG 1 cut(s) 263
FspBI CTAG 1 cut(s) 185
Hin1II CATG 1 cut(s) 181
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 3 cut(s) 36, 238, 311
Hpy188III TCNNGA 1 cut(s) 185
Hpy8I GTNNAC 1 cut(s) 6
HpyAV CCTTC 1 cut(s) 12
HpyCH4V TGCA 1 cut(s) 303
Hsp92II CATG 1 cut(s) 181
LmnI GCTCC 1 cut(s) 119
LpnPI CCDG 3 cut(s) 31, 157, 197
MaeI CTAG 1 cut(s) 185
MaeIII GTNAC 1 cut(s) 193
MboII GAAGA 1 cut(s) 222
MluCI AATT 3 cut(s) 89, 142, 165
MslI CAYNNNNRTG 2 cut(s) 36, 108
NlaIII CATG 1 cut(s) 181
NlaIV GGNNCC 1 cut(s) 121
NmuCI GTSAC 1 cut(s) 193
NspI RCATGY 1 cut(s) 181
PciI ACATGT 1 cut(s) 177
PscI ACATGT 1 cut(s) 177
PspN4I GGNNCC 1 cut(s) 121
RsaI GTAC 3 cut(s) 64, 176, 255
RsaNI GTAC 3 cut(s) 63, 175, 254
RseI CAYNNNNRTG 2 cut(s) 36, 108
SetI ASST 3 cut(s) 50, 216, 268
SgeI CNNG 8 cut(s) 21, 58, 109, 151, 184, 190, 197, 224
SmiMI CAYNNNNRTG 2 cut(s) 36, 108
Sse9I AATT 3 cut(s) 89, 142, 165
SspMI CTAG 1 cut(s) 185
TasI AATT 3 cut(s) 89, 142, 165
TatI WGTACW 1 cut(s) 253
TseFI GTSAC 1 cut(s) 193
Tsp45I GTSAC 1 cut(s) 193
TspDTI ATGAA 3 cut(s) 98, 206, 222
TspGWI ACGGA 1 cut(s) 255
XapI RAATTY 2 cut(s) 142, 165
XbaI TCTAGA 1 cut(s) 184
XceI RCATGY 1 cut(s) 181
XspI CTAG 1 cut(s) 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.