Rroxscaffold_4G00325350

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
57078529 .. 57079880
1352 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00325350.1

Sequence Viewer

Length: 165 bp
ATGGTGGTTCCATTACAACCAATATTGAGCATGACCGAGCATGCAAAATCGAGCCCAAGTGGCGAGGTCAACACCAGCAGAAATGATGATTTGGCCATTGATCATGGTAAAGAGGAGGAAGTAATAGTTCTGAACTTTATGAAGAAGTCGAGGATCGGAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

5.98

Weight (kDa)

6.03

Isoelectric Point (pI)

52.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 161
AcoI YGGCCR 1 cut(s) 93
AlwI GGATC 1 cut(s) 161
AoxI GGCC 1 cut(s) 93
BalI TGGCCA 1 cut(s) 95
BanII GRGCYC 1 cut(s) 56
BclI TGATCA 1 cut(s) 100
BglI GCCNNNNNGGC 1 cut(s) 60
BmiI GGNNCC 1 cut(s) 9
BseRI GAGGAG 1 cut(s) 128
BshFI GGCC 1 cut(s) 95
BsnI GGCC 1 cut(s) 95
Bsp1286I GDGCHC 1 cut(s) 56
Bsp143I GATC 2 cut(s) 100, 153
BspANI GGCC 1 cut(s) 95
BspLI GGNNCC 1 cut(s) 9
BspPI GGATC 1 cut(s) 161
BssMI GATC 2 cut(s) 100, 153
BstC8I GCNNGC 1 cut(s) 42
BstKTI GATC 2 cut(s) 103, 156
BstMBI GATC 2 cut(s) 100, 153
BstMWI GCNNNNNNNGC 1 cut(s) 60
BstNSI RCATGY 1 cut(s) 44
BsuRI GGCC 1 cut(s) 95
Cac8I GCNNGC 1 cut(s) 42
CviAII CATG 3 cut(s) 31, 41, 104
CviJI RGCY 2 cut(s) 54, 95
CviKI_1 RGCY 2 cut(s) 54, 95
DpnI GATC 2 cut(s) 102, 155
DpnII GATC 2 cut(s) 100, 153
EaeI YGGCCR 1 cut(s) 93
Eco24I GRGCYC 1 cut(s) 56
EcoT38I GRGCYC 1 cut(s) 56
FaeI CATG 3 cut(s) 34, 44, 107
FaiI YATR 4 cut(s) 32, 42, 105, 140
FatI CATG 3 cut(s) 30, 40, 103
FbaI TGATCA 1 cut(s) 100
FriOI GRGCYC 1 cut(s) 56
HaeIII GGCC 1 cut(s) 95
Hin1II CATG 3 cut(s) 34, 44, 107
HincII GTYRAC 1 cut(s) 70
HindII GTYRAC 1 cut(s) 70
Hpy166II GTNNAC 1 cut(s) 70
Hpy188I TCNGA 2 cut(s) 132, 158
Hpy8I GTNNAC 1 cut(s) 70
HpyCH4V TGCA 1 cut(s) 44
HpyF10VI GCNNNNNNNGC 1 cut(s) 60
Hsp92II CATG 3 cut(s) 34, 44, 107
Ksp22I TGATCA 1 cut(s) 100
Kzo9I GATC 2 cut(s) 100, 153
LpnPI CCDG 1 cut(s) 88
MalI GATC 2 cut(s) 102, 155
MboI GATC 2 cut(s) 100, 153
MboII GAAGA 1 cut(s) 154
MhlI GDGCHC 1 cut(s) 56
MlsI TGGCCA 1 cut(s) 95
MluNI TGGCCA 1 cut(s) 95
MnlI CCTC 4 cut(s) 58, 106, 109, 144
Mox20I TGGCCA 1 cut(s) 95
MscI TGGCCA 1 cut(s) 95
Msp20I TGGCCA 1 cut(s) 95
MwoI GCNNNNNNNGC 1 cut(s) 60
NdeII GATC 2 cut(s) 100, 153
NlaIII CATG 3 cut(s) 34, 44, 107
NlaIV GGNNCC 1 cut(s) 9
NspI RCATGY 1 cut(s) 44
PaeI GCATGC 1 cut(s) 44
PspN4I GGNNCC 1 cut(s) 9
Sau3AI GATC 2 cut(s) 100, 153
SduI GDGCHC 1 cut(s) 56
SetI ASST 1 cut(s) 69
SgeI CNNG 8 cut(s) 43, 49, 53, 63, 69, 76, 87, 116
SphI GCATGC 1 cut(s) 44
SspI AATATT 1 cut(s) 24
TaqI TCGA 2 cut(s) 50, 149
TaqII GACCGA 1 cut(s) 50
TspDTI ATGAA 1 cut(s) 155
XceI RCATGY 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.