RchiOBHm_Chr2g0113321
ERF Family

Belongs to the major facilitator superfamily. Sugar transporter (TC 2.A.1.1) family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
25482233 .. 25482707
475 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ48667

Sequence Viewer

Length: 141 bp
ATGGAACTTTGTTATTCTCTTTTTGGTTCTTTATCAAATGTGGGTGCCATGGTGGGGGCTATAGCCAGTGGTCAGATTTCTGAGTATATTGGGCGCAAAGGGTCTTTAATGATCGCCACCATTCCTAATGTCATCGGCTAG

Protein Analysis

46

Amino Acids

4.72

Weight (kDa)

5.89

Isoelectric Point (pI)

4.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sugar_tr PF00083 5 - 46 2.7e-06 Sugar (and other) transporter
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 54
AspLEI GCGC 1 cut(s) 96
BanI GGYRCC 1 cut(s) 44
BfaI CTAG 1 cut(s) 139
BfmI CTRYAG 1 cut(s) 60
BmiI GGNNCC 1 cut(s) 46
BsaJI CCNNGG 1 cut(s) 48
Bsc4I CCNNNNNNNGG 1 cut(s) 54
Bse1I ACTGG 1 cut(s) 66
BseDI CCNNGG 1 cut(s) 48
BseLI CCNNNNNNNGG 1 cut(s) 54
BseMII CTCAG 1 cut(s) 72
BseNI ACTGG 1 cut(s) 66
BshNI GGYRCC 1 cut(s) 44
BslI CCNNNNNNNGG 1 cut(s) 54
Bsp143I GATC 1 cut(s) 111
Bsp19I CCATGG 1 cut(s) 48
BspCNI CTCAG 1 cut(s) 73
BspLI GGNNCC 1 cut(s) 46
BspT107I GGYRCC 1 cut(s) 44
BsrI ACTGG 1 cut(s) 66
BssECI CCNNGG 1 cut(s) 48
BssMI GATC 1 cut(s) 111
BssT1I CCWWGG 1 cut(s) 48
BstDEI CTNAG 1 cut(s) 81
BstDSI CCRYGG 1 cut(s) 48
BstHHI GCGC 1 cut(s) 96
BstKTI GATC 1 cut(s) 114
BstMBI GATC 1 cut(s) 111
BstSFI CTRYAG 1 cut(s) 60
BtgI CCRYGG 1 cut(s) 48
BtsIMutI CAGTG 1 cut(s) 73
CfoI GCGC 1 cut(s) 96
CviAII CATG 1 cut(s) 49
CviJI RGCY 3 cut(s) 59, 65, 138
CviKI_1 RGCY 3 cut(s) 59, 65, 138
DdeI CTNAG 1 cut(s) 81
DpnI GATC 1 cut(s) 113
DpnII GATC 1 cut(s) 111
Eco130I CCWWGG 1 cut(s) 48
EcoT14I CCWWGG 1 cut(s) 48
ErhI CCWWGG 1 cut(s) 48
FaeI CATG 1 cut(s) 52
FaiI YATR 3 cut(s) 50, 62, 87
FatI CATG 1 cut(s) 48
FspBI CTAG 1 cut(s) 139
GlaI GCGC 1 cut(s) 95
HhaI GCGC 1 cut(s) 96
Hin1II CATG 1 cut(s) 52
Hin6I GCGC 1 cut(s) 94
HinP1I GCGC 1 cut(s) 94
Hpy188I TCNGA 2 cut(s) 75, 82
HpyF3I CTNAG 1 cut(s) 81
Hsp92II CATG 1 cut(s) 52
HspAI GCGC 1 cut(s) 94
Kzo9I GATC 1 cut(s) 111
LpnPI CCDG 1 cut(s) 79
MaeI CTAG 1 cut(s) 139
MalI GATC 1 cut(s) 113
MboI GATC 1 cut(s) 111
MseI TTAA 1 cut(s) 107
NcoI CCATGG 1 cut(s) 48
NdeII GATC 1 cut(s) 111
NlaIII CATG 1 cut(s) 52
NlaIV GGNNCC 1 cut(s) 46
PspN4I GGNNCC 1 cut(s) 46
SaqAI TTAA 1 cut(s) 107
Sau3AI GATC 1 cut(s) 111
SfcI CTRYAG 1 cut(s) 60
SgeI CNNG 2 cut(s) 61, 78
SspMI CTAG 1 cut(s) 139
StyI CCWWGG 1 cut(s) 48
Tru1I TTAA 1 cut(s) 107
Tru9I TTAA 1 cut(s) 107
TscAI CASTG 1 cut(s) 73
TspRI CASTG 1 cut(s) 73
XspI CTAG 1 cut(s) 139
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.