RchiOBHm_Chr6g0286231
ERF Family

Belongs to the major facilitator superfamily. Sugar transporter (TC 2.A.1.1) family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
49529642 .. 49530411
770 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ25674

Sequence Viewer

Length: 273 bp
ATGGGTTCCAGGCAATCCAGTATGATGGGTTCGTCTCAGGTCATGAGAGATAGCTCCATTTCTGTAGTCGCTTGTGTTCTGATTGTCGCTTTGGGTCCTATCCAATTCGGCTTCACTCAATCATCGTTGATCTTGGACTCTCAGTTATTCTCTTTTTGGTTCTTTATCAAATGTGGGTGCCATGGTGGGGCTATAGCCAGTGGTCAGATTTCTGAGTATATTGGGCGCAAAGGGTCTTTAATGATCGCCACCATTCCTAATGTCATCGGCTAG

Protein Analysis

90

Amino Acids

9.52

Weight (kDa)

8.63

Isoelectric Point (pI)

45.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 177
AfiI CCNNNNNNNGG 1 cut(s) 187
AjnI CCWGG 1 cut(s) 8
AluBI AGCT 1 cut(s) 54
AluI AGCT 1 cut(s) 54
Alw26I GTCTC 1 cut(s) 39
AspLEI GCGC 1 cut(s) 228
AspS9I GGNCC 1 cut(s) 95
AvaII GGWCC 1 cut(s) 95
BanI GGYRCC 1 cut(s) 177
BccI CCATC 1 cut(s) 19
BciT130I CCWGG 1 cut(s) 10
BcoDI GTCTC 1 cut(s) 39
BfaI CTAG 1 cut(s) 271
BfmI CTRYAG 2 cut(s) 63, 192
Bme1390I CCNGG 1 cut(s) 10
Bme18I GGWCC 1 cut(s) 95
BmgT120I GGNCC 1 cut(s) 95
BmiI GGNNCC 3 cut(s) 7, 96, 179
BmrFI CCNGG 1 cut(s) 10
BsaJI CCNNGG 1 cut(s) 181
Bsc4I CCNNNNNNNGG 1 cut(s) 187
Bse1I ACTGG 2 cut(s) 18, 198
BseBI CCWGG 1 cut(s) 10
BseDI CCNNGG 1 cut(s) 181
BseLI CCNNNNNNNGG 1 cut(s) 187
BseMII CTCAG 3 cut(s) 50, 155, 204
BseNI ACTGG 2 cut(s) 18, 198
BshNI GGYRCC 1 cut(s) 177
BslI CCNNNNNNNGG 1 cut(s) 187
BsmAI GTCTC 1 cut(s) 39
BsmBI CGTCTC 1 cut(s) 39
Bsp143I GATC 2 cut(s) 129, 243
Bsp19I CCATGG 1 cut(s) 181
BspCNI CTCAG 3 cut(s) 49, 154, 205
BspHI TCATGA 1 cut(s) 42
BspLI GGNNCC 3 cut(s) 7, 96, 179
BspT107I GGYRCC 1 cut(s) 177
BsrI ACTGG 2 cut(s) 18, 198
BssECI CCNNGG 1 cut(s) 181
BssMI GATC 2 cut(s) 129, 243
BssT1I CCWWGG 1 cut(s) 181
Bst2UI CCWGG 1 cut(s) 10
BstDEI CTNAG 3 cut(s) 36, 141, 213
BstDSI CCRYGG 1 cut(s) 181
BstHHI GCGC 1 cut(s) 228
BstKTI GATC 2 cut(s) 132, 246
BstMAI GTCTC 1 cut(s) 39
BstMBI GATC 2 cut(s) 129, 243
BstNI CCWGG 1 cut(s) 10
BstSCI CCNGG 1 cut(s) 8
BstSFI CTRYAG 2 cut(s) 63, 192
BstXI CCANNNNNNTGG 1 cut(s) 25
BtgI CCRYGG 1 cut(s) 181
BtsIMutI CAGTG 1 cut(s) 205
CciI TCATGA 1 cut(s) 42
CfoI GCGC 1 cut(s) 228
Cfr13I GGNCC 1 cut(s) 95
CviAII CATG 2 cut(s) 43, 182
CviJI RGCY 5 cut(s) 54, 111, 191, 197, 270
CviKI_1 RGCY 5 cut(s) 54, 111, 191, 197, 270
DdeI CTNAG 3 cut(s) 36, 141, 213
DpnI GATC 2 cut(s) 131, 245
DpnII GATC 2 cut(s) 129, 243
Eco130I CCWWGG 1 cut(s) 181
Eco47I GGWCC 1 cut(s) 95
EcoO109I RGGNCCY 1 cut(s) 95
EcoRII CCWGG 1 cut(s) 8
EcoT14I CCWWGG 1 cut(s) 181
ErhI CCWWGG 1 cut(s) 181
Esp3I CGTCTC 1 cut(s) 39
FaeI CATG 2 cut(s) 46, 185
FaiI YATR 5 cut(s) 23, 44, 183, 194, 219
FatI CATG 2 cut(s) 42, 181
FspBI CTAG 1 cut(s) 271
GlaI GCGC 1 cut(s) 227
HhaI GCGC 1 cut(s) 228
Hin1II CATG 2 cut(s) 46, 185
Hin6I GCGC 1 cut(s) 226
HinP1I GCGC 1 cut(s) 226
HinfI GANTC 1 cut(s) 137
Hpy188I TCNGA 3 cut(s) 81, 207, 214
Hpy188III TCNNGA 1 cut(s) 43
HpyF3I CTNAG 3 cut(s) 36, 141, 213
Hsp92II CATG 2 cut(s) 46, 185
HspAI GCGC 1 cut(s) 226
Kzo9I GATC 2 cut(s) 129, 243
LmnI GCTCC 1 cut(s) 59
LpnPI CCDG 4 cut(s) 22, 23, 31, 211
MaeI CTAG 1 cut(s) 271
MalI GATC 2 cut(s) 131, 245
MboI GATC 2 cut(s) 129, 243
MluCI AATT 1 cut(s) 104
MlyI GAGTC 1 cut(s) 131
MseI TTAA 1 cut(s) 239
MspR9I CCNGG 1 cut(s) 10
MvaI CCWGG 1 cut(s) 10
NcoI CCATGG 1 cut(s) 181
NdeII GATC 2 cut(s) 129, 243
NlaIII CATG 2 cut(s) 46, 185
NlaIV GGNNCC 3 cut(s) 7, 96, 179
PagI TCATGA 1 cut(s) 42
PleI GAGTC 1 cut(s) 131
PpsI GAGTC 1 cut(s) 131
PpuMI RGGWCCY 1 cut(s) 95
Psp5II RGGWCCY 1 cut(s) 95
Psp6I CCWGG 1 cut(s) 8
PspGI CCWGG 1 cut(s) 8
PspN4I GGNNCC 3 cut(s) 7, 96, 179
PspPI GGNCC 1 cut(s) 95
PspPPI RGGWCCY 1 cut(s) 95
PsrI GAACNNNNNNTAC 2 cut(s) 13, 45
SaqAI TTAA 1 cut(s) 239
Sau3AI GATC 2 cut(s) 129, 243
Sau96I GGNCC 1 cut(s) 95
SchI GAGTC 1 cut(s) 131
ScrFI CCNGG 1 cut(s) 10
SetI ASST 2 cut(s) 42, 56
SfcI CTRYAG 2 cut(s) 63, 192
SgeI CNNG 9 cut(s) 21, 22, 30, 50, 55, 84, 145, 194, 210
SinI GGWCC 1 cut(s) 95
Sse9I AATT 1 cut(s) 104
SspMI CTAG 1 cut(s) 271
StyD4I CCNGG 1 cut(s) 8
StyI CCWWGG 1 cut(s) 181
TasI AATT 1 cut(s) 104
Tru1I TTAA 1 cut(s) 239
Tru9I TTAA 1 cut(s) 239
TscAI CASTG 1 cut(s) 205
TspRI CASTG 1 cut(s) 205
VpaK11BI GGWCC 1 cut(s) 95
XspI CTAG 1 cut(s) 271
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.