Rh6CG295000
ERF Family

Belongs to the major facilitator superfamily. Sugar transporter (TC 2.A.1.1) family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Reverse (-)
47359155 .. 47359785
631 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG295000.1

Sequence Viewer

Length: 300 bp
ATGGGTTCCAGGCAATCCAGTATGATGGGTTCGTCTCAGGTCATGAGAGATAGCTCCATTTCTGTAGTCGCTTGTGTTCTGATTGTCGCTTTGGGTCCTATCCAATTCGGCTTCACTTCTGGATATTCTTCTCTGACTCAAGCAGCAATCATCGTTGATCTTGGACTCTCATATTCTCTTTTTGGTTCTTTATCAAATGTGGGTGCCATGGTGGGGGCTATAGCCAGTGGTCAGATTTCTGAGTATATTGGGCGCAAAGGGTCTTTAATGATCGCCACCATTCCTAATGTCATCGGCTAG

Protein Analysis

99

Amino Acids

10.08

Weight (kDa)

7.92

Isoelectric Point (pI)

23.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 203
AfiI CCNNNNNNNGG 1 cut(s) 213
AjnI CCWGG 1 cut(s) 8
AluBI AGCT 1 cut(s) 54
AluI AGCT 1 cut(s) 54
Alw26I GTCTC 1 cut(s) 39
ApeKI GCWGC 1 cut(s) 143
AspLEI GCGC 1 cut(s) 255
AspS9I GGNCC 1 cut(s) 95
AvaII GGWCC 1 cut(s) 95
BanI GGYRCC 1 cut(s) 203
BbvI GCAGC 1 cut(s) 155
BccI CCATC 1 cut(s) 19
BciT130I CCWGG 1 cut(s) 10
BcoDI GTCTC 1 cut(s) 39
BfaI CTAG 1 cut(s) 298
BfmI CTRYAG 2 cut(s) 63, 219
BisI GCNGC 1 cut(s) 144
BlsI GCNGC 1 cut(s) 145
Bme1390I CCNGG 1 cut(s) 10
Bme18I GGWCC 1 cut(s) 95
BmgT120I GGNCC 1 cut(s) 95
BmiI GGNNCC 3 cut(s) 7, 96, 205
BmrFI CCNGG 1 cut(s) 10
BpuEI CTTGAG 1 cut(s) 123
BsaJI CCNNGG 1 cut(s) 207
Bsc4I CCNNNNNNNGG 1 cut(s) 213
Bse1I ACTGG 2 cut(s) 18, 225
BseBI CCWGG 1 cut(s) 10
BseDI CCNNGG 1 cut(s) 207
BseLI CCNNNNNNNGG 1 cut(s) 213
BseMII CTCAG 2 cut(s) 50, 231
BseNI ACTGG 2 cut(s) 18, 225
BseXI GCAGC 1 cut(s) 155
BshNI GGYRCC 1 cut(s) 203
BslI CCNNNNNNNGG 1 cut(s) 213
BsmAI GTCTC 1 cut(s) 39
BsmBI CGTCTC 1 cut(s) 39
Bsp143I GATC 2 cut(s) 157, 270
Bsp19I CCATGG 1 cut(s) 207
BspCNI CTCAG 2 cut(s) 49, 232
BspHI TCATGA 1 cut(s) 42
BspLI GGNNCC 3 cut(s) 7, 96, 205
BspT107I GGYRCC 1 cut(s) 203
BsrI ACTGG 2 cut(s) 18, 225
BssECI CCNNGG 1 cut(s) 207
BssMI GATC 2 cut(s) 157, 270
BssT1I CCWWGG 1 cut(s) 207
Bst2UI CCWGG 1 cut(s) 10
BstDEI CTNAG 2 cut(s) 36, 240
BstDSI CCRYGG 1 cut(s) 207
BstHHI GCGC 1 cut(s) 255
BstKTI GATC 2 cut(s) 160, 273
BstMAI GTCTC 1 cut(s) 39
BstMBI GATC 2 cut(s) 157, 270
BstNI CCWGG 1 cut(s) 10
BstSCI CCNGG 1 cut(s) 8
BstSFI CTRYAG 2 cut(s) 63, 219
BstV1I GCAGC 1 cut(s) 155
BstXI CCANNNNNNTGG 1 cut(s) 25
BtgI CCRYGG 1 cut(s) 207
BtsIMutI CAGTG 1 cut(s) 232
CciI TCATGA 1 cut(s) 42
CfoI GCGC 1 cut(s) 255
Cfr13I GGNCC 1 cut(s) 95
CviAII CATG 2 cut(s) 43, 208
CviJI RGCY 5 cut(s) 54, 111, 218, 224, 297
CviKI_1 RGCY 5 cut(s) 54, 111, 218, 224, 297
DdeI CTNAG 2 cut(s) 36, 240
DpnI GATC 2 cut(s) 159, 272
DpnII GATC 2 cut(s) 157, 270
Eco130I CCWWGG 1 cut(s) 207
Eco47I GGWCC 1 cut(s) 95
EcoO109I RGGNCCY 1 cut(s) 95
EcoRII CCWGG 1 cut(s) 8
EcoT14I CCWWGG 1 cut(s) 207
ErhI CCWWGG 1 cut(s) 207
Esp3I CGTCTC 1 cut(s) 39
FaeI CATG 2 cut(s) 46, 211
FaiI YATR 6 cut(s) 23, 44, 172, 209, 221, 246
FatI CATG 2 cut(s) 42, 207
Fnu4HI GCNGC 1 cut(s) 144
Fsp4HI GCNGC 1 cut(s) 144
FspBI CTAG 1 cut(s) 298
GlaI GCGC 1 cut(s) 254
GluI GCNGC 1 cut(s) 144
HhaI GCGC 1 cut(s) 255
Hin1II CATG 2 cut(s) 46, 211
Hin6I GCGC 1 cut(s) 253
HinP1I GCGC 1 cut(s) 253
HinfI GANTC 2 cut(s) 136, 165
Hpy188I TCNGA 4 cut(s) 81, 135, 234, 241
Hpy188III TCNNGA 2 cut(s) 43, 120
HpyF3I CTNAG 2 cut(s) 36, 240
Hsp92II CATG 2 cut(s) 46, 211
HspAI GCGC 1 cut(s) 253
Kzo9I GATC 2 cut(s) 157, 270
LmnI GCTCC 1 cut(s) 59
LpnPI CCDG 5 cut(s) 22, 23, 31, 105, 238
Lsp1109I GCAGC 1 cut(s) 155
MaeI CTAG 1 cut(s) 298
MalI GATC 2 cut(s) 159, 272
MboI GATC 2 cut(s) 157, 270
MboII GAAGA 1 cut(s) 120
MluCI AATT 1 cut(s) 104
MlyI GAGTC 2 cut(s) 130, 159
MseI TTAA 1 cut(s) 266
MspR9I CCNGG 1 cut(s) 10
MvaI CCWGG 1 cut(s) 10
NcoI CCATGG 1 cut(s) 207
NdeII GATC 2 cut(s) 157, 270
NlaIII CATG 2 cut(s) 46, 211
NlaIV GGNNCC 3 cut(s) 7, 96, 205
PagI TCATGA 1 cut(s) 42
PkrI GCNGC 1 cut(s) 145
PleI GAGTC 2 cut(s) 130, 159
PpsI GAGTC 2 cut(s) 130, 159
PpuMI RGGWCCY 1 cut(s) 95
Psp5II RGGWCCY 1 cut(s) 95
Psp6I CCWGG 1 cut(s) 8
PspGI CCWGG 1 cut(s) 8
PspN4I GGNNCC 3 cut(s) 7, 96, 205
PspPI GGNCC 1 cut(s) 95
PspPPI RGGWCCY 1 cut(s) 95
PsrI GAACNNNNNNTAC 2 cut(s) 13, 45
SaqAI TTAA 1 cut(s) 266
SatI GCNGC 1 cut(s) 144
Sau3AI GATC 2 cut(s) 157, 270
Sau96I GGNCC 1 cut(s) 95
SchI GAGTC 2 cut(s) 130, 159
ScrFI CCNGG 1 cut(s) 10
SetI ASST 2 cut(s) 42, 56
SfcI CTRYAG 2 cut(s) 63, 219
SinI GGWCC 1 cut(s) 95
SmlI CTYRAG 1 cut(s) 138
SmoI CTYRAG 1 cut(s) 138
Sse9I AATT 1 cut(s) 104
SspMI CTAG 1 cut(s) 298
StyD4I CCNGG 1 cut(s) 8
StyI CCWWGG 1 cut(s) 207
TasI AATT 1 cut(s) 104
Tru1I TTAA 1 cut(s) 266
Tru9I TTAA 1 cut(s) 266
TscAI CASTG 1 cut(s) 232
TseI GCWGC 1 cut(s) 143
TspRI CASTG 1 cut(s) 232
VpaK11BI GGWCC 1 cut(s) 95
XspI CTAG 1 cut(s) 298
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.