RchiOBHm_Chr5g0052551

GPI ethanolamine phosphate transferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
54567922 .. 54570141
2220 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32995

Sequence Viewer

Length: 186 bp
ATGATAGTTTATGTCAATTTGTGTACTCAGATTTGTAAGTCTTCAATATTTTTCTGCTTTAAGAATCAAAGCCATACAACAGGTGGACTGCTGACTTTTATTGATGTTGGGAATAGCTTTGGTGCTCTAGCAATTGTTGAAGATAATTTGTTACATCAGTTCCATAGCCTTGCCTTTCTATCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

6.76

Weight (kDa)

6.21

Isoelectric Point (pI)

15.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 25
AgsI TTSAA 2 cut(s) 45, 140
AluBI AGCT 1 cut(s) 117
AluI AGCT 1 cut(s) 117
Alw21I GWGCWC 1 cut(s) 127
BbsI GAAGAC 1 cut(s) 33
Bbv12I GWGCWC 1 cut(s) 127
BfaI CTAG 1 cut(s) 128
BpiI GAAGAC 1 cut(s) 33
BseMII CTCAG 1 cut(s) 41
BsiHKAI GWGCWC 1 cut(s) 127
Bsp1286I GDGCHC 1 cut(s) 127
BspCNI CTCAG 1 cut(s) 40
BstDEI CTNAG 1 cut(s) 27
BstV2I GAAGAC 1 cut(s) 33
Csp6I GTAC 1 cut(s) 24
CviJI RGCY 3 cut(s) 72, 117, 168
CviKI_1 RGCY 3 cut(s) 72, 117, 168
CviQI GTAC 1 cut(s) 24
DdeI CTNAG 1 cut(s) 27
FaiI YATR 4 cut(s) 12, 75, 165, 184
FspBI CTAG 1 cut(s) 128
FspEI CC 8 cut(s) 66, 69, 86, 93, 94, 105, 176, 182
HinfI GANTC 1 cut(s) 64
Hpy166II GTNNAC 2 cut(s) 24, 86
Hpy188I TCNGA 1 cut(s) 30
Hpy8I GTNNAC 2 cut(s) 24, 86
HpyF3I CTNAG 1 cut(s) 27
LpnPI CCDG 1 cut(s) 66
MaeI CTAG 1 cut(s) 128
MaeIII GTNAC 1 cut(s) 150
MboII GAAGA 2 cut(s) 33, 152
MfeI CAATTG 1 cut(s) 132
MhlI GDGCHC 1 cut(s) 127
MluCI AATT 3 cut(s) 16, 132, 145
MseI TTAA 1 cut(s) 60
MunI CAATTG 1 cut(s) 132
PfeI GAWTC 1 cut(s) 64
RsaI GTAC 1 cut(s) 25
RsaNI GTAC 1 cut(s) 24
SaqAI TTAA 1 cut(s) 60
SduI GDGCHC 1 cut(s) 127
SetI ASST 2 cut(s) 85, 119
SgeI CNNG 3 cut(s) 93, 140, 182
Sse9I AATT 3 cut(s) 16, 132, 145
SspI AATATT 1 cut(s) 48
SspMI CTAG 1 cut(s) 128
TasI AATT 3 cut(s) 16, 132, 145
TatI WGTACW 1 cut(s) 23
TfiI GAWTC 1 cut(s) 64
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
XcmI CCANNNNNNNNNTGG 1 cut(s) 80
XspI CTAG 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.