Rh2AG517000

Cell cycle regulated microtubule associated protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
74400333 .. 74400697
365 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG517000.1

Sequence Viewer

Length: 183 bp
ATGCTGTCGGCGACGGAAGAACCCAACACGATGACGTCCTCGACAATGATGATGATTGACGAGATTTATGAGTTCTCAGCCCCGCGCTTCTTCGATTTCATCAAGGACGAGACTGACGACGACAAGATCAAGGCCGAGCTTTGGTTCGATTCCCTTCCCGCGACGGACGCGACGGACGGGTAG

Protein Analysis

60

Amino Acids

6.86

Weight (kDa)

4.05

Isoelectric Point (pI)

36.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 38
AccII CGCG 3 cut(s) 85, 161, 170
AciI CCGC 2 cut(s) 83, 159
AcyI GRCGYC 1 cut(s) 35
AfiI CCNNNNNNNGG 1 cut(s) 141
AluBI AGCT 1 cut(s) 139
AluI AGCT 1 cut(s) 139
Alw26I GTCTC 1 cut(s) 104
AoxI GGCC 1 cut(s) 132
AspLEI GCGC 1 cut(s) 87
BcoDI GTCTC 1 cut(s) 104
BsaHI GRCGYC 1 cut(s) 35
Bsc4I CCNNNNNNNGG 1 cut(s) 141
BseLI CCNNNNNNNGG 1 cut(s) 141
BseMII CTCAG 1 cut(s) 90
Bsh1236I CGCG 3 cut(s) 85, 161, 170
BshFI GGCC 1 cut(s) 134
BslI CCNNNNNNNGG 1 cut(s) 141
BsmAI GTCTC 1 cut(s) 104
BsnI GGCC 1 cut(s) 134
Bsp143I GATC 1 cut(s) 126
BspACI CCGC 2 cut(s) 83, 159
BspANI GGCC 1 cut(s) 134
BspCNI CTCAG 1 cut(s) 89
BspFNI CGCG 3 cut(s) 85, 161, 170
BssMI GATC 1 cut(s) 126
BssNI GRCGYC 1 cut(s) 35
BstACI GRCGYC 1 cut(s) 35
BstDEI CTNAG 1 cut(s) 76
BstFNI CGCG 3 cut(s) 85, 161, 170
BstHHI GCGC 1 cut(s) 87
BstKTI GATC 1 cut(s) 129
BstMAI GTCTC 1 cut(s) 104
BstMBI GATC 1 cut(s) 126
BstMWI GCNNNNNNNGC 1 cut(s) 167
BstUI CGCG 3 cut(s) 85, 161, 170
BsuRI GGCC 1 cut(s) 134
CfoI GCGC 1 cut(s) 87
CseI GACGC 1 cut(s) 176
CviJI RGCY 3 cut(s) 80, 134, 139
CviKI_1 RGCY 3 cut(s) 80, 134, 139
DdeI CTNAG 1 cut(s) 76
DpnI GATC 1 cut(s) 128
DpnII GATC 1 cut(s) 126
FaiI YATR 1 cut(s) 69
FauI CCCGC 2 cut(s) 90, 166
GlaI GCGC 1 cut(s) 86
HaeIII GGCC 1 cut(s) 134
HgaI GACGC 1 cut(s) 176
HhaI GCGC 1 cut(s) 87
Hin1I GRCGYC 1 cut(s) 35
Hin6I GCGC 1 cut(s) 85
HinP1I GCGC 1 cut(s) 85
HinfI GANTC 1 cut(s) 149
Hpy99I CGWCG 4 cut(s) 16, 122, 166, 175
HpyAV CCTTC 1 cut(s) 164
HpyCH4IV ACGT 1 cut(s) 35
HpyF10VI GCNNNNNNNGC 1 cut(s) 167
HpyF3I CTNAG 1 cut(s) 76
HpySE526I ACGT 1 cut(s) 35
Hsp92I GRCGYC 1 cut(s) 35
HspAI GCGC 1 cut(s) 85
Kzo9I GATC 1 cut(s) 126
MaeII ACGT 1 cut(s) 35
MalI GATC 1 cut(s) 128
MboI GATC 1 cut(s) 126
MboII GAAGA 2 cut(s) 29, 82
MnlI CCTC 1 cut(s) 49
MvnI CGCG 3 cut(s) 85, 161, 170
MwoI GCNNNNNNNGC 1 cut(s) 167
NdeII GATC 1 cut(s) 126
NmeAIII GCCGAG 1 cut(s) 160
PcsI WCGNNNNNNNCGW 1 cut(s) 114
PfeI GAWTC 1 cut(s) 149
Sau3AI GATC 1 cut(s) 126
SetI ASST 2 cut(s) 38, 141
SsiI CCGC 2 cut(s) 83, 159
TaiI ACGT 1 cut(s) 38
TaqI TCGA 3 cut(s) 41, 93, 147
TfiI GAWTC 1 cut(s) 149
TspDTI ATGAA 1 cut(s) 88
TspGWI ACGGA 2 cut(s) 29, 179
ZraI GACGTC 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.