RchiOBHm_Chr5g0071501

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
77318848 .. 77322445
3598 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ34658

Sequence Viewer

Length: 162 bp
ATGGAAAATGATGTAAACCTAAGTGAGCACAGTGGCAAGGTTCTTCTGATTGTGAATGTTGCTTCAAAATGGTTTTTGGCTGGATTTGATGTGAATTTGGAGGTTCTGCATATGGAAGAAGTTGACAAAATAAAGAAAAGAGTTCGGGTTTGGTTACTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.16

Weight (kDa)

6.03

Isoelectric Point (pI)

16.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 94
AgsI TTSAA 1 cut(s) 66
Alw21I GWGCWC 1 cut(s) 30
ApoI RAATTY 1 cut(s) 94
Bbv12I GWGCWC 1 cut(s) 30
BsiHKAI GWGCWC 1 cut(s) 30
Bsp1286I GDGCHC 1 cut(s) 30
Bst4CI ACNGT 1 cut(s) 32
BstDEI CTNAG 1 cut(s) 20
BtsIMutI CAGTG 1 cut(s) 37
CviJI RGCY 1 cut(s) 80
CviKI_1 RGCY 1 cut(s) 80
DdeI CTNAG 1 cut(s) 20
FaiI YATR 2 cut(s) 111, 113
FauNDI CATATG 1 cut(s) 111
HincII GTYRAC 1 cut(s) 124
HindII GTYRAC 1 cut(s) 124
Hpy166II GTNNAC 2 cut(s) 16, 124
Hpy188I TCNGA 2 cut(s) 48, 161
Hpy8I GTNNAC 2 cut(s) 16, 124
HpyCH4III ACNGT 1 cut(s) 32
HpyCH4V TGCA 1 cut(s) 109
HpyF3I CTNAG 1 cut(s) 20
LpnPI CCDG 1 cut(s) 66
MaeIII GTNAC 1 cut(s) 153
MboII GAAGA 2 cut(s) 35, 128
MhlI GDGCHC 1 cut(s) 30
MluCI AATT 1 cut(s) 94
MnlI CCTC 1 cut(s) 94
NdeI CATATG 1 cut(s) 111
SduI GDGCHC 1 cut(s) 30
SetI ASST 3 cut(s) 21, 42, 105
SgeI CNNG 3 cut(s) 49, 93, 158
Sse9I AATT 1 cut(s) 94
TaaI ACNGT 1 cut(s) 32
TasI AATT 1 cut(s) 94
TscAI CASTG 1 cut(s) 37
TspRI CASTG 1 cut(s) 37
XapI RAATTY 1 cut(s) 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.