Rh4CG174100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0002613
Physical Location & Seq
Forward (+)
38011117 .. 38011389
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG174100.1

Sequence Viewer

Length: 273 bp
ATGATGCGTAATGGTGTGATACCTAATGCAGTTTCCTACAACAACATGATACATGGCTATTGCACAATAGGGGATATGGATTGTGCAAATAATGAATTTTTGGAGATGACACAAAGGGGTTTGGAACCTACTGTTTTTACTTACTCTATTTTGATGAATGGGTATTTCAGGAACGGTAATGCCGAACGTGCTTTTAATGTCTTTGATGATATGGTGGATGCAAAGAAAATCCCCACAGGCTACACAATTAACATTGTCATTGATGGCCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.14

Weight (kDa)

4.6

Isoelectric Point (pI)

8.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_3 PF13812 1 - 54 5.9e-10 Pentatricopeptide repeat domain
PPR_1 PF12854 4 - 31 1.9e-07 PPR repeat
PPR_2 PF13041 8 - 56 3.6e-17 PPR repeat family
PPR_1 PF12854 39 - 72 2.2e-12 PPR repeat
PPR PF01535 46 - 73 1e-07 PPR repeat
PPR_2 PF13041 50 - 90 5.9e-10 PPR repeat family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 95
AoxI GGCC 1 cut(s) 265
ApoI RAATTY 1 cut(s) 95
BccI CCATC 1 cut(s) 257
BmiI GGNNCC 1 cut(s) 126
BmsI GCATC 1 cut(s) 208
BseGI GGATG 1 cut(s) 223
BshFI GGCC 1 cut(s) 267
BsnI GGCC 1 cut(s) 267
BspANI GGCC 1 cut(s) 267
BspLI GGNNCC 1 cut(s) 126
Bst4CI ACNGT 2 cut(s) 133, 176
BstF5I GGATG 1 cut(s) 223
BstMWI GCNNNNNNNGC 1 cut(s) 188
BsuRI GGCC 1 cut(s) 267
BtsCI GGATG 1 cut(s) 223
CviAII CATG 2 cut(s) 46, 53
CviJI RGCY 3 cut(s) 57, 240, 267
CviKI_1 RGCY 3 cut(s) 57, 240, 267
FaeI CATG 2 cut(s) 49, 56
FaiI YATR 4 cut(s) 47, 54, 77, 212
FatI CATG 2 cut(s) 45, 52
FokI GGATG 1 cut(s) 230
HaeIII GGCC 1 cut(s) 267
Hin1II CATG 2 cut(s) 49, 56
Hpy188III TCNNGA 1 cut(s) 169
HpyCH4III ACNGT 2 cut(s) 133, 176
HpyCH4IV ACGT 1 cut(s) 187
HpyCH4V TGCA 4 cut(s) 29, 63, 86, 221
HpyF10VI GCNNNNNNNGC 1 cut(s) 188
HpySE526I ACGT 1 cut(s) 187
Hsp92II CATG 2 cut(s) 49, 56
LpnPI CCDG 2 cut(s) 154, 222
LweI GCATC 1 cut(s) 208
MaeII ACGT 1 cut(s) 187
MluCI AATT 2 cut(s) 95, 246
MseI TTAA 2 cut(s) 195, 249
MwoI GCNNNNNNNGC 1 cut(s) 188
NlaIII CATG 2 cut(s) 49, 56
NlaIV GGNNCC 1 cut(s) 126
PcsI WCGNNNNNNNCGW 1 cut(s) 180
PspN4I GGNNCC 1 cut(s) 126
SaqAI TTAA 2 cut(s) 195, 249
SetI ASST 3 cut(s) 25, 130, 190
SfaNI GCATC 1 cut(s) 208
SgeI CNNG 5 cut(s) 58, 65, 181, 200, 249
Sse9I AATT 2 cut(s) 95, 246
TaaI ACNGT 2 cut(s) 133, 176
TaiI ACGT 1 cut(s) 190
TasI AATT 2 cut(s) 95, 246
Tru1I TTAA 2 cut(s) 195, 249
Tru9I TTAA 2 cut(s) 195, 249
TspDTI ATGAA 2 cut(s) 108, 170
XapI RAATTY 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.