RchiOBHm_Chr5g0078211

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
84144369 .. 84146777
2409 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35275

Sequence Viewer

Length: 156 bp
ATGGGAGGGTGGCCTCCCTACGAAGTATCGGCCGACCTCCACCATAACGAGGTAGCTGGGGTGTCGGACTACCGGATGCATGTCGTAGGCGGGACTAGCCATGTCGCGGGGCCTACCTACGAGGTTGTTGCTTATGCTTGGCAGTATGTAATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.6

Weight (kDa)

5.21

Isoelectric Point (pI)

28.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 107
AciI CCGC 2 cut(s) 90, 107
AcoI YGGCCR 1 cut(s) 30
AfiI CCNNNNNNNGG 2 cut(s) 49, 106
AluBI AGCT 1 cut(s) 56
AluI AGCT 1 cut(s) 56
AoxI GGCC 3 cut(s) 11, 30, 110
AspS9I GGNCC 1 cut(s) 110
BcgI CGANNNNNNTGC 2 cut(s) 110, 144
BfaI CTAG 1 cut(s) 96
BmgT120I GGNCC 1 cut(s) 110
BmiI GGNNCC 1 cut(s) 111
BmsI GCATC 1 cut(s) 66
BsaWI WCCGGW 1 cut(s) 72
Bsc4I CCNNNNNNNGG 2 cut(s) 49, 106
BseGI GGATG 1 cut(s) 81
BseLI CCNNNNNNNGG 2 cut(s) 49, 106
BseX3I CGGCCG 1 cut(s) 30
BseYI CCCAGC 1 cut(s) 56
Bsh1236I CGCG 1 cut(s) 107
Bsh1285I CGRYCG 1 cut(s) 33
BshFI GGCC 3 cut(s) 13, 32, 112
BsiEI CGRYCG 1 cut(s) 33
BsiSI CCGG 1 cut(s) 73
BslFI GGGAC 1 cut(s) 106
BslI CCNNNNNNNGG 2 cut(s) 49, 106
BsmFI GGGAC 1 cut(s) 106
BsnI GGCC 3 cut(s) 13, 32, 112
BspACI CCGC 2 cut(s) 90, 107
BspANI GGCC 3 cut(s) 13, 32, 112
BspFNI CGCG 1 cut(s) 107
BspLI GGNNCC 1 cut(s) 111
BstF5I GGATG 1 cut(s) 81
BstFNI CGCG 1 cut(s) 107
BstMCI CGRYCG 1 cut(s) 33
BstMWI GCNNNNNNNGC 1 cut(s) 96
BstNSI RCATGY 1 cut(s) 83
BstUI CGCG 1 cut(s) 107
BstZI CGGCCG 1 cut(s) 30
BsuRI GGCC 3 cut(s) 13, 32, 112
BtsCI GGATG 1 cut(s) 81
Cfr13I GGNCC 1 cut(s) 110
CviAII CATG 2 cut(s) 80, 101
CviJI RGCY 5 cut(s) 13, 32, 56, 99, 112
CviKI_1 RGCY 5 cut(s) 13, 32, 56, 99, 112
EaeI YGGCCR 1 cut(s) 30
EagI CGGCCG 1 cut(s) 30
EclXI CGGCCG 1 cut(s) 30
Eco52I CGGCCG 1 cut(s) 30
EcoO109I RGGNCCY 1 cut(s) 110
EcoT22I ATGCAT 1 cut(s) 81
FaeI CATG 2 cut(s) 83, 104
FaiI YATR 6 cut(s) 45, 81, 102, 135, 147, 154
FaqI GGGAC 1 cut(s) 106
FatI CATG 2 cut(s) 79, 100
FauI CCCGC 2 cut(s) 83, 100
FokI GGATG 1 cut(s) 88
FspBI CTAG 1 cut(s) 96
GsaI CCCAGC 1 cut(s) 60
HaeIII GGCC 3 cut(s) 13, 32, 112
HapII CCGG 1 cut(s) 73
Hin1II CATG 2 cut(s) 83, 104
HpaII CCGG 1 cut(s) 73
Hpy188I TCNGA 1 cut(s) 67
HpyCH4V TGCA 1 cut(s) 79
HpyF10VI GCNNNNNNNGC 1 cut(s) 96
Hsp92II CATG 2 cut(s) 83, 104
LpnPI CCDG 2 cut(s) 42, 86
LweI GCATC 1 cut(s) 66
MaeI CTAG 1 cut(s) 96
MmeI TCCRAC 1 cut(s) 45
MnlI CCTC 4 cut(s) 24, 43, 47, 115
Mph1103I ATGCAT 1 cut(s) 81
MspI CCGG 1 cut(s) 73
MvnI CGCG 1 cut(s) 107
MwoI GCNNNNNNNGC 1 cut(s) 96
NlaIII CATG 2 cut(s) 83, 104
NlaIV GGNNCC 1 cut(s) 111
NsiI ATGCAT 1 cut(s) 81
NspI RCATGY 1 cut(s) 83
PspFI CCCAGC 1 cut(s) 56
PspN4I GGNNCC 1 cut(s) 111
PspPI GGNCC 1 cut(s) 110
Sau96I GGNCC 1 cut(s) 110
SetI ASST 5 cut(s) 39, 54, 58, 119, 126
SfaNI GCATC 1 cut(s) 66
SsiI CCGC 2 cut(s) 90, 107
SspMI CTAG 1 cut(s) 96
XceI RCATGY 1 cut(s) 83
XspI CTAG 1 cut(s) 96
Zsp2I ATGCAT 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.