Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004277.1

Orthogroup ID

OG0004840

Physical Location & Seq

Genomic Coordinates Forward (+)

222443 .. 224755

Gene Structure 2313 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004277.1_g000060.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1191 bp

atgagagctgccaggtacggaggtgaagatccgggtgcccaaagaagatttgcatgtccaaaggaaactaccggtgagacagagcaagctgctgaccggtgtgcacgggaggtaaggtttatcagcgtgtccaagtacaaattggtaactccaggaccagttgatgaatgtggccaacgagatcaaattaactcatggccagtgtgcgtgaaaaggcagatgcgagagagaagggaccgggttgatgcggtcttgagtggtgagatagtacccgatggctcagggtacccggagaaggggcttgggagtggggttgagagtacggtgatgtacatgtacccgctggctcagtgtacccgctggctcagaggcttgggtgaggggtgtcctgcatgtacccatgtacaaggtgactcatggtacccactcatgacccttcctcgaggtgcgggcctcttggagagcacggcaaggtggcctcctggcaagataccggccaacctccatcatgacaacttagctcgggtgtcggtctacaggatgcatgccataggcggggctagccatgtcgtggggcccacctataaggtcgttgcttatgcttggcgcaatcagagggacacattagtatcaggtacttttaacactcttattgatggtttttacaaagcagggagaatacaagatgcaaaaaagttgttttctgatatgcaaggttgtggccaacctccaaatgttcgaacttataatattttagttgatggcctgtgtaacaaccaacaactttctaaagcactagaattgcttagagaaatggaaggcaacaagttggaactaaatattgtagtttacaatactatcattgaatgtttgtgcaaagctgggaaaatggattctgcaatagatgtcttccctggtttgtcatcaaagcatcttcaacctaatgtgcggacgtataatataatgattcttggattttgtaaaggaggcctattaagcgaagctcaaaaattgttcacagaaatgaaggagaaaggctgttctccagatggttgtacctataacacaattatccgaggttttatgattaacaatgacacatcaagggctttgggacttattcaagaaatgcgtgagaggggtcactactacaaaaactgcatcacacaacggtggaaatctgttgtgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

396

Amino Acids

44.15

Weight (kDa)

8.94

Isoelectric Point (pI)

45.84

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004840)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g03870 FvH4_2g07542
rosa_chinensis	RchiOBHm_Chr5g0078211
rosa_multiflora	Rmu_sc0000777.1_g000012 Rmu_sc0002148.1_g000027 Rmu_sc0002538.1_g000027 Rmu_sc0002662.1_g000006 Rmu_sc0004277.1_g000060 Rmu_sc0004295.1_g000013 Rmu_sc0004607.1_g000001 Rmu_sc0006862.1_g000010 Rmu_sc0007315.1_g000010 Rmu_sc0007681.1_g000016 Rmu_sc0010265.1_g000010 Rmu_sc0024414.1_g000002 Rmu_sc0025517.1_g000001
rosa_roxburghii	Rroxscaffold_1G00043280 Rroxscaffold_2G00103140 Rroxscaffold_2G00121790 Rroxscaffold_2G00123140 Rroxscaffold_3G00248480 Rroxscaffold_3G00267950 Rroxscaffold_5G00342740 Rroxscaffold_5G00374520 Rroxscaffold_6G00389230
rosa_rugosa	Rorug02G0190000 Rorug06G0080500 Rorug07G0304100
rosa_samantha	Rh4DG074400 Rh4DG074500
rosa_wichuraiana	Rw0G002790

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	747
AbsI	CCTCGAGG	1 cut(s)	441
Acc65I	GGTACC	2 cut(s)	285, 420
AccB1I	GGYRCC	3 cut(s)	35, 285, 420
AccB7I	CCANNNNNTGG	1 cut(s)	571
AccI	GTMKAC	1 cut(s)	534
AciI	CCGC	6 cut(s)	248, 341, 358, 449, 555, 949
AclWI	GGATC	1 cut(s)	23
AcoI	YGGCCR	4 cut(s)	172, 197, 495, 721
AfiI	CCNNNNNNNGG	4 cut(s)	295, 296, 555, 571
AflIII	ACRYGT	1 cut(s)	333
AgeI	ACCGGT	2 cut(s)	71, 96
AgsI	TTSAA	3 cut(s)	866, 938, 1124
AjnI	CCWGG	4 cut(s)	11, 151, 481, 913
AleI	CACNNNNGTG	1 cut(s)	1171
AluBI	AGCT	5 cut(s)	8, 89, 521, 881, 1004
AluI	AGCT	5 cut(s)	8, 89, 521, 881, 1004
Alw21I	GWGCWC	2 cut(s)	106, 467
Alw26I	GTCTC	1 cut(s)	71
Alw44I	GTGCAC	1 cut(s)	102
AlwI	GGATC	1 cut(s)	23
Ama87I	CYCGRG	2 cut(s)	441, 522
AoxI	GGCC	9 cut(s)	172, 197, 451, 476, 495, 575, 721, 763, 988
ApaI	GGGCCC	1 cut(s)	579
ApaLI	GTGCAC	1 cut(s)	102
ApeKI	GCWGC	2 cut(s)	8, 89
AsiGI	ACCGGT	2 cut(s)	71, 96
Asp718I	GGTACC	2 cut(s)	285, 420
AspLEI	GCGC	1 cut(s)	609
AspS9I	GGNCC	5 cut(s)	155, 235, 451, 575, 576
AsuC2I	CCSGG	3 cut(s)	33, 239, 290
AsuHPI	GGTGA	6 cut(s)	35, 86, 272, 337, 389, 422
AsuII	TTCGAA	1 cut(s)	739
AsuNHI	GCTAGC	1 cut(s)	560
AvaI	CYCGRG	2 cut(s)	441, 522
AvaII	GGWCC	2 cut(s)	155, 235
BaeGI	GKGCMC	3 cut(s)	40, 106, 579
BaeI	ACNNNNGTAYC	4 cut(s)	7, 40, 612, 645
BalI	TGGCCA	3 cut(s)	174, 199, 723
BanI	GGYRCC	3 cut(s)	35, 285, 420
BanII	GRGCYC	1 cut(s)	579
BbsI	GAAGAC	1 cut(s)	901
Bbv12I	GWGCWC	2 cut(s)	106, 467
BbvI	GCAGC	1 cut(s)	76
BccI	CCATC	5 cut(s)	269, 513, 650, 755, 1043
BceAI	ACGGC	1 cut(s)	483
BciT130I	CCWGG	4 cut(s)	13, 153, 483, 915
BcnI	CCSGG	3 cut(s)	33, 239, 290
BcoDI	GTCTC	1 cut(s)	71
BfaI	CTAG	2 cut(s)	561, 797
BfmI	CTRYAG	1 cut(s)	535
BisI	GCNGC	2 cut(s)	9, 90
BlsI	GCNGC	2 cut(s)	10, 91
Bme1390I	CCNGG	7 cut(s)	13, 33, 153, 239, 290, 483, 915
Bme18I	GGWCC	2 cut(s)	155, 235
BmeT110I	CYCGRG	2 cut(s)	441, 522
BmgT120I	GGNCC	5 cut(s)	155, 235, 451, 575, 576
BmiI	GGNNCC	6 cut(s)	37, 236, 287, 422, 576, 577
BmrFI	CCNGG	7 cut(s)	13, 33, 153, 239, 290, 483, 915
BmsI	GCATC	6 cut(s)	210, 235, 531, 676, 940, 1170
BmtI	GCTAGC	1 cut(s)	564
BpiI	GAAGAC	1 cut(s)	901
BpmI	CTGGAG	2 cut(s)	135, 1029
Bpu10I	CCTNAGC	1 cut(s)	280
Bpu14I	TTCGAA	1 cut(s)	739
BpuEI	CTTGAG	1 cut(s)	274
BpuMI	CCSGG	3 cut(s)	33, 239, 290
BsaJI	CCNNGG	2 cut(s)	913, 1075
BsaWI	WCCGGW	2 cut(s)	71, 96
BsaXI	ACNNNNNCTCC	2 cut(s)	101, 131
Bsc4I	CCNNNNNNNGG	4 cut(s)	295, 296, 555, 571
Bse118I	RCCGGY	3 cut(s)	71, 96, 493
Bse1I	ACTGG	2 cut(s)	158, 200
BseBI	CCWGG	4 cut(s)	13, 153, 483, 915
BseDI	CCNNGG	2 cut(s)	913, 1075
BseGI	GGATG	1 cut(s)	546
BseLI	CCNNNNNNNGG	4 cut(s)	295, 296, 555, 571
BseMII	CTCAG	3 cut(s)	294, 362, 379
BseNI	ACTGG	2 cut(s)	158, 200
BseSI	GKGCMC	3 cut(s)	40, 106, 579
BseXI	GCAGC	1 cut(s)	76
BseYI	CCCAGC	1 cut(s)	881
BshFI	GGCC	9 cut(s)	174, 199, 453, 478, 497, 577, 723, 765, 990
BshNI	GGYRCC	3 cut(s)	35, 285, 420
BshTI	ACCGGT	2 cut(s)	71, 96
BsiHKAI	GWGCWC	2 cut(s)	106, 467
BsiHKCI	CYCGRG	2 cut(s)	441, 522
BsiSI	CCGG	6 cut(s)	32, 72, 97, 238, 290, 494
BslFI	GGGAC	3 cut(s)	248, 632, 1128
BslI	CCNNNNNNNGG	4 cut(s)	295, 296, 555, 571
BsmAI	GTCTC	1 cut(s)	71
BsmFI	GGGAC	3 cut(s)	248, 632, 1128
BsnI	GGCC	9 cut(s)	174, 199, 453, 478, 497, 577, 723, 765, 990
BsoBI	CYCGRG	2 cut(s)	441, 522
Bsp119I	TTCGAA	1 cut(s)	739
Bsp120I	GGGCCC	1 cut(s)	575
Bsp1286I	GDGCHC	4 cut(s)	40, 106, 467, 579
Bsp1407I	TGTACA	2 cut(s)	330, 403
Bsp143I	GATC	2 cut(s)	28, 181
BspACI	CCGC	6 cut(s)	248, 341, 358, 449, 555, 949
BspANI	GGCC	9 cut(s)	174, 199, 453, 478, 497, 577, 723, 765, 990
BspCNI	CTCAG	3 cut(s)	293, 361, 378
BspHI	TCATGA	2 cut(s)	429, 508
BspLI	GGNNCC	6 cut(s)	37, 236, 287, 422, 576, 577
BspOI	GCTAGC	1 cut(s)	564
BspPI	GGATC	1 cut(s)	23
BspT104I	TTCGAA	1 cut(s)	739
BspT107I	GGYRCC	3 cut(s)	35, 285, 420
BsrFI	RCCGGY	3 cut(s)	71, 96, 493
BsrGI	TGTACA	2 cut(s)	330, 403
BsrI	ACTGG	2 cut(s)	158, 200
BssAI	RCCGGY	3 cut(s)	71, 96, 493
BssECI	CCNNGG	2 cut(s)	913, 1075
BssMI	GATC	2 cut(s)	28, 181
Bst2UI	CCWGG	4 cut(s)	13, 153, 483, 915
Bst4CI	ACNGT	2 cut(s)	325, 1173
BstAUI	TGTACA	2 cut(s)	330, 403
BstBI	TTCGAA	1 cut(s)	739
BstC8I	GCNNGC	6 cut(s)	87, 345, 362, 451, 546, 562
BstDEI	CTNAG	5 cut(s)	280, 348, 365, 517, 806
BstF5I	GGATG	1 cut(s)	546
BstHHI	GCGC	1 cut(s)	609
BstKTI	GATC	2 cut(s)	31, 184
BstMAI	GTCTC	1 cut(s)	71
BstMBI	GATC	2 cut(s)	28, 181
BstMWI	GCNNNNNNNGC	2 cut(s)	561, 996
BstNI	CCWGG	4 cut(s)	13, 153, 483, 915
BstNSI	RCATGY	4 cut(s)	57, 337, 396, 548
BstSCI	CCNGG	7 cut(s)	11, 31, 151, 237, 288, 481, 913
BstSFI	CTRYAG	1 cut(s)	535
BstSLI	GKGCMC	3 cut(s)	40, 106, 579
BstV1I	GCAGC	1 cut(s)	76
BstV2I	GAAGAC	1 cut(s)	901
BstX2I	RGATCY	1 cut(s)	28
BstYI	RGATCY	1 cut(s)	28
BsuRI	GGCC	9 cut(s)	174, 199, 453, 478, 497, 577, 723, 765, 990
BtsCI	GGATG	1 cut(s)	546
BtsIMutI	CAGTG	2 cut(s)	207, 356
Cac8I	GCNNGC	6 cut(s)	87, 345, 362, 451, 546, 562
CciI	TCATGA	2 cut(s)	429, 508
CfoI	GCGC	1 cut(s)	609
Cfr10I	RCCGGY	3 cut(s)	71, 96, 493
Cfr13I	GGNCC	5 cut(s)	155, 235, 451, 575, 576
CspAI	ACCGGT	2 cut(s)	71, 96
DdeI	CTNAG	5 cut(s)	280, 348, 365, 517, 806
DpnI	GATC	2 cut(s)	30, 183
DpnII	GATC	2 cut(s)	28, 181
EaeI	YGGCCR	4 cut(s)	172, 197, 495, 721
Eco147I	AGGCCT	1 cut(s)	990
Eco24I	GRGCYC	1 cut(s)	579
Eco47I	GGWCC	2 cut(s)	155, 235
Eco88I	CYCGRG	2 cut(s)	441, 522
EcoO109I	RGGNCCY	1 cut(s)	575
EcoRII	CCWGG	4 cut(s)	11, 151, 481, 913
EcoT22I	ATGCAT	1 cut(s)	546
EcoT38I	GRGCYC	1 cut(s)	579
FaqI	GGGAC	3 cut(s)	248, 632, 1128
FauI	CCCGC	4 cut(s)	348, 365, 442, 548
FblI	GTMKAC	1 cut(s)	534
Fnu4HI	GCNGC	2 cut(s)	9, 90
FokI	GGATG	1 cut(s)	553
FriOI	GRGCYC	1 cut(s)	579
Fsp4HI	GCNGC	2 cut(s)	9, 90
FspBI	CTAG	2 cut(s)	561, 797
GlaI	GCGC	1 cut(s)	608
GluI	GCNGC	2 cut(s)	9, 90
GsaI	CCCAGC	1 cut(s)	885
GsuI	CTGGAG	2 cut(s)	135, 1029
HaeIII	GGCC	9 cut(s)	174, 199, 453, 478, 497, 577, 723, 765, 990
HapII	CCGG	6 cut(s)	32, 72, 97, 238, 290, 494
HhaI	GCGC	1 cut(s)	609
Hin6I	GCGC	1 cut(s)	607
HinP1I	GCGC	1 cut(s)	607
HinfI	GANTC	3 cut(s)	413, 893, 967
HpaII	CCGG	6 cut(s)	32, 72, 97, 238, 290, 494
HphI	GGTGA	6 cut(s)	35, 86, 272, 337, 389, 422
Hpy166II	GTNNAC	5 cut(s)	104, 354, 535, 850, 1017
Hpy188I	TCNGA	4 cut(s)	368, 615, 706, 1076
Hpy188III	TCNNGA	5 cut(s)	253, 430, 509, 1046, 1124
Hpy8I	GTNNAC	5 cut(s)	104, 354, 535, 850, 1017
HpyAV	CCTTC	5 cut(s)	225, 289, 446, 812, 1021
HpyCH4III	ACNGT	2 cut(s)	325, 1173
HpyCH4IV	ACGT	1 cut(s)	953
HpyCH4V	TGCA	9 cut(s)	53, 104, 392, 544, 689, 712, 876, 899, 1161
HpyF10VI	GCNNNNNNNGC	2 cut(s)	561, 996
HpyF3I	CTNAG	5 cut(s)	280, 348, 365, 517, 806
HpySE526I	ACGT	1 cut(s)	953
HspAI	GCGC	1 cut(s)	607
KpnI	GGTACC	2 cut(s)	289, 424
Kzo9I	GATC	2 cut(s)	28, 181
Lsp1109I	GCAGC	1 cut(s)	76
LweI	GCATC	6 cut(s)	210, 235, 531, 676, 940, 1170
MaeI	CTAG	2 cut(s)	561, 797
MaeII	ACGT	1 cut(s)	953
MaeIII	GTNAC	4 cut(s)	145, 410, 770, 1142
MalI	GATC	2 cut(s)	30, 183
MboI	GATC	2 cut(s)	28, 181
MboII	GAAGA	4 cut(s)	38, 57, 901, 926
MflI	RGATCY	1 cut(s)	28
MhlI	GDGCHC	4 cut(s)	40, 106, 467, 579
MlsI	TGGCCA	3 cut(s)	174, 199, 723
MluCI	AATT	5 cut(s)	140, 186, 800, 1010, 1068
MluNI	TGGCCA	3 cut(s)	174, 199, 723
MlyI	GAGTC	1 cut(s)	407
MmeI	TCCRAC	1 cut(s)	810
Mox20I	TGGCCA	3 cut(s)	174, 199, 723
Mph1103I	ATGCAT	1 cut(s)	546
MscI	TGGCCA	3 cut(s)	174, 199, 723
MseI	TTAA	4 cut(s)	189, 642, 995, 1089
MslI	CAYNNNNRTG	2 cut(s)	1022, 1171
Msp20I	TGGCCA	3 cut(s)	174, 199, 723
MspA1I	CMGCKG	2 cut(s)	343, 360
MspI	CCGG	6 cut(s)	32, 72, 97, 238, 290, 494
MspR9I	CCNGG	7 cut(s)	13, 33, 153, 239, 290, 483, 915
MvaI	CCWGG	4 cut(s)	13, 153, 483, 915
MwoI	GCNNNNNNNGC	2 cut(s)	561, 996
NciI	CCSGG	3 cut(s)	33, 239, 290
NdeII	GATC	2 cut(s)	28, 181
NheI	GCTAGC	1 cut(s)	560
NlaIV	GGNNCC	6 cut(s)	37, 236, 287, 422, 576, 577
NmuCI	GTSAC	2 cut(s)	410, 1142
NsiI	ATGCAT	1 cut(s)	546
NspI	RCATGY	4 cut(s)	57, 337, 396, 548
NspV	TTCGAA	1 cut(s)	739
OliI	CACNNNNGTG	1 cut(s)	1171
PaeI	GCATGC	1 cut(s)	548
PaeR7I	CTCGAG	1 cut(s)	441
PagI	TCATGA	2 cut(s)	429, 508
PceI	AGGCCT	1 cut(s)	990
PciI	ACATGT	1 cut(s)	333
PfeI	GAWTC	2 cut(s)	893, 967
PflMI	CCANNNNNTGG	1 cut(s)	571
PfoI	TCCNGGA	1 cut(s)	151
PinAI	ACCGGT	2 cut(s)	71, 96
PkrI	GCNGC	2 cut(s)	10, 91
PleI	GAGTC	1 cut(s)	407
PpsI	GAGTC	1 cut(s)	407
PscI	ACATGT	1 cut(s)	333
PsiI	TTATAA	1 cut(s)	747
Psp6I	CCWGG	4 cut(s)	11, 151, 481, 913
PspFI	CCCAGC	1 cut(s)	881
PspGI	CCWGG	4 cut(s)	11, 151, 481, 913
PspN4I	GGNNCC	6 cut(s)	37, 236, 287, 422, 576, 577
PspOMI	GGGCCC	1 cut(s)	575
PspPI	GGNCC	5 cut(s)	155, 235, 451, 575, 576
PspXI	VCTCGAGB	1 cut(s)	441
PsuI	RGATCY	1 cut(s)	28
RseI	CAYNNNNRTG	2 cut(s)	1022, 1171
SaqAI	TTAA	4 cut(s)	189, 642, 995, 1089
SatI	GCNGC	2 cut(s)	9, 90
Sau3AI	GATC	2 cut(s)	28, 181
Sau96I	GGNCC	5 cut(s)	155, 235, 451, 575, 576
SchI	GAGTC	1 cut(s)	407
ScrFI	CCNGG	7 cut(s)	13, 33, 153, 239, 290, 483, 915
SduI	GDGCHC	4 cut(s)	40, 106, 467, 579
SfaNI	GCATC	6 cut(s)	210, 235, 531, 676, 940, 1170
SfcI	CTRYAG	1 cut(s)	535
Sfr274I	CTCGAG	1 cut(s)	441
SfuI	TTCGAA	1 cut(s)	739
SinI	GGWCC	2 cut(s)	155, 235
SlaI	CTCGAG	1 cut(s)	441
SmiMI	CAYNNNNRTG	2 cut(s)	1022, 1171
SmlI	CTYRAG	2 cut(s)	253, 441
SmoI	CTYRAG	2 cut(s)	253, 441
SphI	GCATGC	1 cut(s)	548
Sse9I	AATT	5 cut(s)	140, 186, 800, 1010, 1068
SseBI	AGGCCT	1 cut(s)	990
SsiI	CCGC	6 cut(s)	248, 341, 358, 449, 555, 949
SspI	AATATT	2 cut(s)	751, 841
SspMI	CTAG	2 cut(s)	561, 797
StuI	AGGCCT	1 cut(s)	990
StyD4I	CCNGG	7 cut(s)	11, 31, 151, 237, 288, 481, 913
TaaI	ACNGT	2 cut(s)	325, 1173
TaiI	ACGT	1 cut(s)	956
TaqI	TCGA	2 cut(s)	442, 739
TaqII	GACCGA	1 cut(s)	520
TasI	AATT	5 cut(s)	140, 186, 800, 1010, 1068
TatI	WGTACW	3 cut(s)	135, 330, 403
TfiI	GAWTC	2 cut(s)	893, 967
Tru1I	TTAA	4 cut(s)	189, 642, 995, 1089
Tru9I	TTAA	4 cut(s)	189, 642, 995, 1089
TscAI	CASTG	2 cut(s)	207, 356
TseFI	GTSAC	2 cut(s)	410, 1142
TseI	GCWGC	2 cut(s)	8, 89
Tsp45I	GTSAC	2 cut(s)	410, 1142
TspDTI	ATGAA	2 cut(s)	180, 1040
TspGWI	ACGGA	1 cut(s)	33
TspRI	CASTG	2 cut(s)	207, 356
Van91I	CCANNNNNTGG	1 cut(s)	571
VneI	GTGCAC	1 cut(s)	102
VpaK11BI	GGWCC	2 cut(s)	155, 235
XceI	RCATGY	4 cut(s)	57, 337, 396, 548
XcmI	CCANNNNNNNNNTGG	1 cut(s)	139
XhoI	CTCGAG	1 cut(s)	441
XmiI	GTMKAC	1 cut(s)	534
XspI	CTAG	2 cut(s)	561, 797
Zsp2I	ATGCAT	1 cut(s)	546

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.