RchiOBHm_Chr6g0310201

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
67605583 .. 67606507
925 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ27895

Sequence Viewer

Length: 249 bp
ATGTTTTTAGATCTTAGATCTGAATCTCTAAGATATACTATCAGATTTGTTCTCATGGTCATTCTCAGTTTTTGTTTTGCCTTTGCTCCTCAAGATGTCCAAGCTGTGAACAAATCTCCTTCTTCTTGTCTACCTTGCTCTGCCATGGAAGAGTTCGTACTCCTATGCAACCACCTCTTCAGATCTCAAGTTTCTTTGCTAAATCTTGGTTTGGTTGTTGTTATCCTTTTATGCAAGATTTTCTCGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.28

Weight (kDa)

7.63

Isoelectric Point (pI)

64.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 130
AcuI CTGAAG 1 cut(s) 163
AfaI GTAC 1 cut(s) 159
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
BarI GAAGNNNNNNTAC 2 cut(s) 141, 173
BglII AGATCT 3 cut(s) 10, 17, 182
BpuEI CTTGAG 2 cut(s) 75, 171
BsaBI GATNNNNATC 1 cut(s) 22
BsaJI CCNNGG 1 cut(s) 144
Bse8I GATNNNNATC 1 cut(s) 22
BseDI CCNNGG 1 cut(s) 144
BseJI GATNNNNATC 1 cut(s) 22
BseMII CTCAG 1 cut(s) 79
BseRI GAGGAG 1 cut(s) 78
Bsp143I GATC 3 cut(s) 10, 17, 182
Bsp19I CCATGG 1 cut(s) 144
BspCNI CTCAG 1 cut(s) 78
BssECI CCNNGG 1 cut(s) 144
BssMI GATC 3 cut(s) 10, 17, 182
BssT1I CCWWGG 1 cut(s) 144
Bst6I CTCTTC 2 cut(s) 144, 182
BstDEI CTNAG 3 cut(s) 14, 29, 65
BstDSI CCRYGG 1 cut(s) 144
BstKTI GATC 3 cut(s) 13, 20, 185
BstMBI GATC 3 cut(s) 10, 17, 182
BstX2I RGATCY 3 cut(s) 10, 17, 182
BstYI RGATCY 3 cut(s) 10, 17, 182
BtgI CCRYGG 1 cut(s) 144
Csp6I GTAC 1 cut(s) 158
CviAII CATG 2 cut(s) 55, 145
CviJI RGCY 1 cut(s) 104
CviKI_1 RGCY 1 cut(s) 104
CviQI GTAC 1 cut(s) 158
DdeI CTNAG 3 cut(s) 14, 29, 65
DpnI GATC 3 cut(s) 12, 19, 184
DpnII GATC 3 cut(s) 10, 17, 182
Eam1104I CTCTTC 2 cut(s) 144, 182
EarI CTCTTC 2 cut(s) 144, 182
Eco130I CCWWGG 1 cut(s) 144
Eco57I CTGAAG 1 cut(s) 163
EcoT14I CCWWGG 1 cut(s) 144
ErhI CCWWGG 1 cut(s) 144
FaeI CATG 2 cut(s) 58, 148
FaiI YATR 5 cut(s) 36, 56, 146, 166, 232
FatI CATG 2 cut(s) 54, 144
FblI GTMKAC 1 cut(s) 130
Hin1II CATG 2 cut(s) 58, 148
HinfI GANTC 1 cut(s) 23
Hpy166II GTNNAC 2 cut(s) 109, 131
Hpy188I TCNGA 3 cut(s) 22, 44, 182
Hpy188III TCNNGA 1 cut(s) 92
Hpy8I GTNNAC 2 cut(s) 109, 131
HpyAV CCTTC 1 cut(s) 129
HpyCH4V TGCA 2 cut(s) 168, 234
HpyF3I CTNAG 3 cut(s) 14, 29, 65
Hsp92II CATG 2 cut(s) 58, 148
Kzo9I GATC 3 cut(s) 10, 17, 182
LmnI GCTCC 1 cut(s) 91
MalI GATC 3 cut(s) 12, 19, 184
MboI GATC 3 cut(s) 10, 17, 182
MboII GAAGA 3 cut(s) 114, 161, 169
MflI RGATCY 3 cut(s) 10, 17, 182
MnlI CCTC 2 cut(s) 99, 185
NcoI CCATGG 1 cut(s) 144
NdeII GATC 3 cut(s) 10, 17, 182
NlaIII CATG 2 cut(s) 58, 148
PfeI GAWTC 1 cut(s) 23
PsuI RGATCY 3 cut(s) 10, 17, 182
RsaI GTAC 1 cut(s) 159
RsaNI GTAC 1 cut(s) 158
Sau3AI GATC 3 cut(s) 10, 17, 182
SetI ASST 3 cut(s) 106, 136, 177
SgeI CNNG 8 cut(s) 67, 104, 113, 138, 147, 157, 200, 218
SmlI CTYRAG 2 cut(s) 90, 186
SmoI CTYRAG 2 cut(s) 90, 186
StyI CCWWGG 1 cut(s) 144
TfiI GAWTC 1 cut(s) 23
XmiI GTMKAC 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.