RchiOBHm_Chr7g0188891

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
8262166 .. 8263350
1185 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ16870

Sequence Viewer

Length: 207 bp
ATGGACATGAAGCAGGAAATGAATATCAATCCACGAATAGCTATTAGTGATCCACTTTGGTTTCCAGATCTTCCGTCATCAAATCATCAAATTAGCATAATCAGATCTTCCTCATCTCCATCAGCATCATCATCGATTTCCAGATCCATAATCTCCAGTTGTAACAGAAATTCAAGCCGAATTTTCGGTATTCCGATCTGTCGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.54

Weight (kDa)

9.68

Isoelectric Point (pI)

87.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 44, 138
AcsI RAATTY 2 cut(s) 169, 180
AgsI TTSAA 1 cut(s) 174
AluBI AGCT 1 cut(s) 41
AluI AGCT 1 cut(s) 41
AlwI GGATC 2 cut(s) 44, 138
ApoI RAATTY 2 cut(s) 169, 180
BccI CCATC 1 cut(s) 127
BcgI CGANNNNNNTGC 2 cut(s) 114, 148
BglII AGATCT 2 cut(s) 67, 104
BmsI GCATC 1 cut(s) 134
BpmI CTGGAG 1 cut(s) 139
Bsa29I ATCGAT 1 cut(s) 134
Bse1I ACTGG 1 cut(s) 156
BseCI ATCGAT 1 cut(s) 134
BseNI ACTGG 1 cut(s) 156
BshVI ATCGAT 1 cut(s) 134
Bsp143I GATC 5 cut(s) 49, 67, 104, 143, 195
BspDI ATCGAT 1 cut(s) 134
BspPI GGATC 2 cut(s) 44, 138
BsrI ACTGG 1 cut(s) 156
BssMI GATC 5 cut(s) 49, 67, 104, 143, 195
BstKTI GATC 5 cut(s) 52, 70, 107, 146, 198
BstMBI GATC 5 cut(s) 49, 67, 104, 143, 195
BstX2I RGATCY 3 cut(s) 67, 104, 143
BstYI RGATCY 3 cut(s) 67, 104, 143
Bsu15I ATCGAT 1 cut(s) 134
BsuTUI ATCGAT 1 cut(s) 134
ClaI ATCGAT 1 cut(s) 134
CviAII CATG 1 cut(s) 7
CviJI RGCY 2 cut(s) 41, 177
CviKI_1 RGCY 2 cut(s) 41, 177
DpnI GATC 5 cut(s) 51, 69, 106, 145, 197
DpnII GATC 5 cut(s) 49, 67, 104, 143, 195
FaeI CATG 1 cut(s) 10
FaiI YATR 3 cut(s) 8, 98, 149
FatI CATG 1 cut(s) 6
GsuI CTGGAG 1 cut(s) 139
Hin1II CATG 1 cut(s) 10
Hpy188I TCNGA 2 cut(s) 104, 195
Hpy188III TCNNGA 2 cut(s) 65, 141
Hsp92II CATG 1 cut(s) 10
Kzo9I GATC 5 cut(s) 49, 67, 104, 143, 195
LpnPI CCDG 3 cut(s) 78, 154, 169
LweI GCATC 1 cut(s) 134
MaeIII GTNAC 1 cut(s) 161
MalI GATC 5 cut(s) 51, 69, 106, 145, 197
MboI GATC 5 cut(s) 49, 67, 104, 143, 195
MboII GAAGA 2 cut(s) 62, 99
MflI RGATCY 3 cut(s) 67, 104, 143
MluCI AATT 3 cut(s) 90, 169, 180
MnlI CCTC 1 cut(s) 121
NdeII GATC 5 cut(s) 49, 67, 104, 143, 195
NlaIII CATG 1 cut(s) 10
PsuI RGATCY 3 cut(s) 67, 104, 143
Sau3AI GATC 5 cut(s) 49, 67, 104, 143, 195
SetI ASST 1 cut(s) 43
SfaNI GCATC 1 cut(s) 134
SgeI CNNG 7 cut(s) 19, 26, 45, 77, 153, 168, 186
Sse9I AATT 3 cut(s) 90, 169, 180
TaqI TCGA 1 cut(s) 134
TasI AATT 3 cut(s) 90, 169, 180
TspDTI ATGAA 2 cut(s) 23, 35
TspGWI ACGGA 1 cut(s) 63
XapI RAATTY 2 cut(s) 169, 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.