RchiOBHm_Chr7g0232001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0001132
Physical Location & Seq
Forward (+)
55890640 .. 55891411
772 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20792

Sequence Viewer

Length: 213 bp
ATGCAGCAACAACAATCTTTTGCAATGAGTGATGGTGTATTTTCTTGGGATACAACTTCTCGACAACACAAAGTTTTGGTGTTCCATATCTTTCTCAGACATTTGATAACTGTATTGGATGCTAATCGGAATTTCAACTTTTGGCTTGGTCTTTTAGCTAGTTTCTTTGTTATTCCTGTCGATCTGTTGATATCAAAACCAATTAATTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.24

Weight (kDa)

8.4

Isoelectric Point (pI)

43.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 130
AgsI TTSAA 1 cut(s) 136
AluBI AGCT 1 cut(s) 158
AluI AGCT 1 cut(s) 158
ApeKI GCWGC 1 cut(s) 4
ApoI RAATTY 1 cut(s) 130
AseI ATTAAT 1 cut(s) 204
BbvI GCAGC 1 cut(s) 16
BccI CCATC 1 cut(s) 26
BciVI GTATCC 1 cut(s) 43
BfaI CTAG 1 cut(s) 159
BfuI GTATCC 1 cut(s) 43
BisI GCNGC 1 cut(s) 5
BlsI GCNGC 1 cut(s) 6
BmsI GCATC 1 cut(s) 109
BsaBI GATNNNNATC 1 cut(s) 123
Bse3DI GCAATG 1 cut(s) 30
Bse8I GATNNNNATC 1 cut(s) 123
BseGI GGATG 1 cut(s) 124
BseJI GATNNNNATC 1 cut(s) 123
BseMI GCAATG 1 cut(s) 30
BseMII CTCAG 1 cut(s) 109
BseXI GCAGC 1 cut(s) 16
Bsp143I GATC 1 cut(s) 181
BspCNI CTCAG 1 cut(s) 108
BsrDI GCAATG 1 cut(s) 30
BssMI GATC 1 cut(s) 181
Bst4CI ACNGT 1 cut(s) 112
BstDEI CTNAG 1 cut(s) 95
BstF5I GGATG 1 cut(s) 124
BstKTI GATC 1 cut(s) 184
BstMBI GATC 1 cut(s) 181
BstV1I GCAGC 1 cut(s) 16
BstXI CCANNNNNNTGG 1 cut(s) 207
BsuI GTATCC 1 cut(s) 43
BtsCI GGATG 1 cut(s) 124
CviJI RGCY 2 cut(s) 145, 158
CviKI_1 RGCY 2 cut(s) 145, 158
DdeI CTNAG 1 cut(s) 95
DpnI GATC 1 cut(s) 183
DpnII GATC 1 cut(s) 181
Eco32I GATATC 1 cut(s) 192
EcoRV GATATC 1 cut(s) 192
FaiI YATR 1 cut(s) 87
Fnu4HI GCNGC 1 cut(s) 5
FokI GGATG 1 cut(s) 131
Fsp4HI GCNGC 1 cut(s) 5
FspBI CTAG 1 cut(s) 159
GluI GCNGC 1 cut(s) 5
Hpy188I TCNGA 2 cut(s) 98, 129
Hpy188III TCNNGA 1 cut(s) 60
HpyCH4III ACNGT 1 cut(s) 112
HpyCH4V TGCA 2 cut(s) 4, 23
HpyF3I CTNAG 1 cut(s) 95
Kzo9I GATC 1 cut(s) 181
LpnPI CCDG 1 cut(s) 189
Lsp1109I GCAGC 1 cut(s) 16
LweI GCATC 1 cut(s) 109
MaeI CTAG 1 cut(s) 159
MalI GATC 1 cut(s) 183
MboI GATC 1 cut(s) 181
MluCI AATT 3 cut(s) 130, 201, 205
MseI TTAA 1 cut(s) 204
NdeII GATC 1 cut(s) 181
PkrI GCNGC 1 cut(s) 6
PshBI ATTAAT 1 cut(s) 204
SaqAI TTAA 1 cut(s) 204
SatI GCNGC 1 cut(s) 5
Sau3AI GATC 1 cut(s) 181
SetI ASST 1 cut(s) 160
SfaNI GCATC 1 cut(s) 109
SgeI CNNG 5 cut(s) 57, 72, 158, 171, 188
Sse9I AATT 3 cut(s) 130, 201, 205
SspMI CTAG 1 cut(s) 159
TaaI ACNGT 1 cut(s) 112
TaqI TCGA 2 cut(s) 61, 180
TasI AATT 3 cut(s) 130, 201, 205
Tru1I TTAA 1 cut(s) 204
Tru9I TTAA 1 cut(s) 204
TseI GCWGC 1 cut(s) 4
VspI ATTAAT 1 cut(s) 204
XapI RAATTY 1 cut(s) 130
XspI CTAG 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.