Rmu_sc0001825.1_g000011

Serine threonine-protein kinase ATM-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001825.1
Physical Location & Seq
Reverse (-)
69159 .. 70134
976 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001825.1_g000011.1.cds

Sequence Viewer

Length: 636 bp
atgagtgttgcaatcgaggggagaggggcttggtcttgctctttgctgcttgctcgtcgttgttcgccggcctctgggcctcggcgtattgggtccaatatttcgcgacggtggggaacggcgtcaggagctgcttgtagatcggcgccgcctccgagatcggcaaacggcgggcctgattggcgtggctttgcttacatttgggtcctgatggttgaagaatttagagttgggaagatggttgaggatgttagagttgagaagatgatggttgaagacggtagagttgacaggatggttgaatatgatggagttaaggagaaggtggatgaggccaaagcattcgaatcgagtatgatgggtgaagatgatcaagattatgattatgatttttgtgtgggtgatattgtgtgggttaaaaccaaaataaacacatggtggcctgctagaattcatgatcctgcagatgcatcaaagtacggaggaattgaaagtgaccaagaagactgtctgctagttgggtactttgggatgggtcatgttgcttggtgccgtcgataccaactgaagcctttccccagtatttcgagcagatttcagggcagagcaaggctagaattttcattaaagctgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

211

Amino Acids

23.84

Weight (kDa)

6.74

Isoelectric Point (pI)

55.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 145, 549
AccII CGCG 1 cut(s) 106
AciI CCGC 2 cut(s) 149, 171
AclWI GGATC 1 cut(s) 452
AcsI RAATTY 3 cut(s) 221, 450, 617
AcuI CTGAAG 1 cut(s) 587
AcyI GRCGYC 2 cut(s) 122, 146
AdeI CACNNNGTG 1 cut(s) 438
AfaI GTAC 2 cut(s) 479, 524
AfiI CCNNNNNNNGG 1 cut(s) 74
AgsI TTSAA 4 cut(s) 218, 275, 302, 491
AjuI GAANNNNNNNTTGG 2 cut(s) 213, 245
AluBI AGCT 2 cut(s) 131, 631
AluI AGCT 2 cut(s) 131, 631
AlwI GGATC 1 cut(s) 452
AlwNI CAGNNNCTG 1 cut(s) 131
AoxI GGCC 5 cut(s) 69, 77, 173, 333, 440
ApeKI GCWGC 2 cut(s) 46, 131
ApoI RAATTY 3 cut(s) 221, 450, 617
Asp700I GAANNNNTTC 1 cut(s) 572
AspLEI GCGC 1 cut(s) 148
AspS9I GGNCC 4 cut(s) 77, 93, 173, 205
AsuHPI GGTGA 2 cut(s) 374, 413
AsuII TTCGAA 1 cut(s) 345
AvaII GGWCC 2 cut(s) 93, 205
BanI GGYRCC 2 cut(s) 145, 549
BbsI GAAGAC 2 cut(s) 282, 510
BbvI GCAGC 2 cut(s) 33, 118
BccI CCATC 7 cut(s) 205, 232, 262, 289, 302, 352, 526
BceAI ACGGC 3 cut(s) 135, 184, 537
BcgI CGANNNNNNTGC 2 cut(s) 330, 364
BclI TGATCA 1 cut(s) 370
BfaI CTAG 3 cut(s) 447, 515, 614
BfmI CTRYAG 2 cut(s) 462, 632
BfoI RGCGCY 1 cut(s) 149
BglI GCCNNNNNGGC 1 cut(s) 181
BisI GCNGC 3 cut(s) 47, 132, 149
BlsI GCNGC 3 cut(s) 48, 133, 150
Bme18I GGWCC 2 cut(s) 93, 205
BmgT120I GGNCC 4 cut(s) 77, 93, 173, 205
BmiI GGNNCC 4 cut(s) 94, 147, 206, 551
BmrI ACTGGG 1 cut(s) 573
BmsI GCATC 2 cut(s) 457, 479
BmuI ACTGGG 1 cut(s) 573
BpiI GAAGAC 2 cut(s) 282, 510
Bpu14I TTCGAA 1 cut(s) 345
BsaHI GRCGYC 2 cut(s) 122, 146
BsaJI CCNNGG 1 cut(s) 80
Bsc4I CCNNNNNNNGG 1 cut(s) 74
Bse118I RCCGGY 1 cut(s) 67
Bse1I ACTGG 1 cut(s) 579
BseDI CCNNGG 1 cut(s) 80
BseGI GGATG 4 cut(s) 253, 300, 334, 537
BseLI CCNNNNNNNGG 1 cut(s) 74
BseNI ACTGG 1 cut(s) 579
BseXI GCAGC 2 cut(s) 33, 118
Bsh1236I CGCG 1 cut(s) 106
BshFI GGCC 5 cut(s) 71, 79, 175, 335, 442
BshNI GGYRCC 2 cut(s) 145, 549
BsiSI CCGG 1 cut(s) 68
BslI CCNNNNNNNGG 1 cut(s) 74
BsmI GAATGC 1 cut(s) 341
BsnI GGCC 5 cut(s) 71, 79, 175, 335, 442
Bsp119I TTCGAA 1 cut(s) 345
Bsp143I GATC 4 cut(s) 140, 158, 370, 457
Bsp68I TCGCGA 1 cut(s) 106
BspACI CCGC 2 cut(s) 149, 171
BspANI GGCC 5 cut(s) 71, 79, 175, 335, 442
BspFNI CGCG 1 cut(s) 106
BspHI TCATGA 1 cut(s) 454
BspLI GGNNCC 4 cut(s) 94, 147, 206, 551
BspMAI CTGCAG 1 cut(s) 466
BspPI GGATC 1 cut(s) 452
BspT104I TTCGAA 1 cut(s) 345
BspT107I GGYRCC 2 cut(s) 145, 549
BsrFI RCCGGY 1 cut(s) 67
BsrI ACTGG 1 cut(s) 579
BssAI RCCGGY 1 cut(s) 67
BssECI CCNNGG 1 cut(s) 80
BssMI GATC 4 cut(s) 140, 158, 370, 457
BssNI GRCGYC 2 cut(s) 122, 146
Bst4CI ACNGT 3 cut(s) 111, 281, 509
BstACI GRCGYC 2 cut(s) 122, 146
BstBI TTCGAA 1 cut(s) 345
BstC8I GCNNGC 4 cut(s) 51, 69, 173, 444
BstF5I GGATG 4 cut(s) 253, 300, 334, 537
BstFNI CGCG 1 cut(s) 106
BstH2I RGCGCY 1 cut(s) 149
BstHHI GCGC 1 cut(s) 148
BstKTI GATC 4 cut(s) 143, 161, 373, 460
BstMBI GATC 4 cut(s) 140, 158, 370, 457
BstMWI GCNNNNNNNGC 2 cut(s) 128, 181
BstSFI CTRYAG 2 cut(s) 462, 632
BstUI CGCG 1 cut(s) 106
BstV1I GCAGC 2 cut(s) 33, 118
BstV2I GAAGAC 2 cut(s) 282, 510
BsuRI GGCC 5 cut(s) 71, 79, 175, 335, 442
BtsCI GGATG 4 cut(s) 253, 300, 334, 537
BtuMI TCGCGA 1 cut(s) 106
Cac8I GCNNGC 4 cut(s) 51, 69, 173, 444
CaiI CAGNNNCTG 1 cut(s) 131
CciI TCATGA 1 cut(s) 454
CfoI GCGC 1 cut(s) 148
Cfr10I RCCGGY 1 cut(s) 67
Cfr13I GGNCC 4 cut(s) 77, 93, 173, 205
CseI GACGC 1 cut(s) 111
Csp6I GTAC 2 cut(s) 478, 523
CviAII CATG 3 cut(s) 435, 455, 539
CviQI GTAC 2 cut(s) 478, 523
DinI GGCGCC 1 cut(s) 147
DpnI GATC 4 cut(s) 142, 160, 372, 459
DpnII GATC 4 cut(s) 140, 158, 370, 457
DraIII CACNNNGTG 1 cut(s) 438
Eco47I GGWCC 2 cut(s) 93, 205
Eco57I CTGAAG 1 cut(s) 587
EcoO109I RGGNCCY 1 cut(s) 205
EcoRI GAATTC 1 cut(s) 450
EcoT22I ATGCAT 1 cut(s) 472
EgeI GGCGCC 1 cut(s) 147
EheI GGCGCC 1 cut(s) 147
FaeI CATG 3 cut(s) 438, 458, 542
FaiI YATR 7 cut(s) 306, 356, 381, 387, 436, 456, 540
FatI CATG 3 cut(s) 434, 454, 538
FauI CCCGC 1 cut(s) 164
FbaI TGATCA 1 cut(s) 370
Fnu4HI GCNGC 3 cut(s) 47, 132, 149
FokI GGATG 4 cut(s) 260, 307, 341, 544
Fsp4HI GCNGC 3 cut(s) 47, 132, 149
FspBI CTAG 3 cut(s) 447, 515, 614
GlaI GCGC 1 cut(s) 147
GluI GCNGC 3 cut(s) 47, 132, 149
HaeII RGCGCY 1 cut(s) 149
HaeIII GGCC 5 cut(s) 71, 79, 175, 335, 442
HapII CCGG 1 cut(s) 68
HgaI GACGC 1 cut(s) 111
HhaI GCGC 1 cut(s) 148
Hin1I GRCGYC 2 cut(s) 122, 146
Hin1II CATG 3 cut(s) 438, 458, 542
Hin6I GCGC 1 cut(s) 146
HinP1I GCGC 1 cut(s) 146
HincII GTYRAC 1 cut(s) 289
HindII GTYRAC 1 cut(s) 289
HinfI GANTC 1 cut(s) 347
HpaII CCGG 1 cut(s) 68
HphI GGTGA 2 cut(s) 374, 413
Hpy166II GTNNAC 1 cut(s) 289
Hpy188I TCNGA 1 cut(s) 156
Hpy188III TCNNGA 5 cut(s) 105, 126, 208, 374, 455
Hpy8I GTNNAC 1 cut(s) 289
Hpy99I CGWCG 3 cut(s) 60, 111, 558
HpyAV CCTTC 1 cut(s) 316
HpyCH4III ACNGT 3 cut(s) 111, 281, 509
HpyCH4V TGCA 3 cut(s) 11, 464, 470
HpyF10VI GCNNNNNNNGC 2 cut(s) 128, 181
Hsp92I GRCGYC 2 cut(s) 122, 146
Hsp92II CATG 3 cut(s) 438, 458, 542
HspAI GCGC 1 cut(s) 146
KasI GGCGCC 1 cut(s) 145
KroI GCCGGC 1 cut(s) 67
KroNI GCCGGC 1 cut(s) 69
Ksp22I TGATCA 1 cut(s) 370
Kzo9I GATC 4 cut(s) 140, 158, 370, 457
LmnI GCTCC 1 cut(s) 128
Lsp1109I GCAGC 2 cut(s) 33, 118
LweI GCATC 2 cut(s) 457, 479
MaeI CTAG 3 cut(s) 447, 515, 614
MaeIII GTNAC 1 cut(s) 494
MalI GATC 4 cut(s) 142, 160, 372, 459
MboI GATC 4 cut(s) 140, 158, 370, 457
MboII GAAGA 6 cut(s) 230, 247, 274, 287, 377, 515
MluCI AATT 4 cut(s) 221, 450, 486, 617
Mly113I GGCGCC 1 cut(s) 146
MnlI CCTC 8 cut(s) 10, 17, 82, 90, 162, 238, 325, 476
Mph1103I ATGCAT 1 cut(s) 472
MroNI GCCGGC 1 cut(s) 67
MroXI GAANNNNTTC 1 cut(s) 572
MseI TTAA 3 cut(s) 315, 417, 626
MspI CCGG 1 cut(s) 68
Mva1269I GAATGC 1 cut(s) 341
MvnI CGCG 1 cut(s) 106
MwoI GCNNNNNNNGC 2 cut(s) 128, 181
NaeI GCCGGC 1 cut(s) 69
NarI GGCGCC 1 cut(s) 146
NdeII GATC 4 cut(s) 140, 158, 370, 457
NgoMIV GCCGGC 1 cut(s) 67
NlaIII CATG 3 cut(s) 438, 458, 542
NlaIV GGNNCC 4 cut(s) 94, 147, 206, 551
NmeAIII GCCGAG 1 cut(s) 61
NmuCI GTSAC 1 cut(s) 494
NruI TCGCGA 1 cut(s) 106
NsiI ATGCAT 1 cut(s) 472
NspV TTCGAA 1 cut(s) 345
PagI TCATGA 1 cut(s) 454
PctI GAATGC 1 cut(s) 341
PdiI GCCGGC 1 cut(s) 69
PdmI GAANNNNTTC 1 cut(s) 572
PfeI GAWTC 1 cut(s) 347
PkrI GCNGC 3 cut(s) 48, 133, 150
PluTI GGCGCC 1 cut(s) 149
PpuMI RGGWCCY 1 cut(s) 205
Psp5II RGGWCCY 1 cut(s) 205
PspN4I GGNNCC 4 cut(s) 94, 147, 206, 551
PspPI GGNCC 4 cut(s) 77, 93, 173, 205
PspPPI RGGWCCY 1 cut(s) 205
PstI CTGCAG 1 cut(s) 466
PstNI CAGNNNCTG 1 cut(s) 131
RruI TCGCGA 1 cut(s) 106
RsaI GTAC 2 cut(s) 479, 524
RsaNI GTAC 2 cut(s) 478, 523
SaqAI TTAA 3 cut(s) 315, 417, 626
SatI GCNGC 3 cut(s) 47, 132, 149
Sau3AI GATC 4 cut(s) 140, 158, 370, 457
Sau96I GGNCC 4 cut(s) 77, 93, 173, 205
SetI ASST 3 cut(s) 133, 327, 633
SfaNI GCATC 2 cut(s) 457, 479
SfcI CTRYAG 2 cut(s) 462, 632
SfoI GGCGCC 1 cut(s) 147
SfuI TTCGAA 1 cut(s) 345
SinI GGWCC 2 cut(s) 93, 205
Sse9I AATT 4 cut(s) 221, 450, 486, 617
SsiI CCGC 2 cut(s) 149, 171
SspDI GGCGCC 1 cut(s) 145
SspI AATATT 1 cut(s) 100
SspMI CTAG 3 cut(s) 447, 515, 614
TaaI ACNGT 3 cut(s) 111, 281, 509
TaqI TCGA 5 cut(s) 15, 345, 350, 556, 587
TasI AATT 4 cut(s) 221, 450, 486, 617
TauI GCSGC 1 cut(s) 151
TfiI GAWTC 1 cut(s) 347
Tru1I TTAA 3 cut(s) 315, 417, 626
Tru9I TTAA 3 cut(s) 315, 417, 626
TseFI GTSAC 1 cut(s) 494
TseI GCWGC 2 cut(s) 46, 131
Tsp45I GTSAC 1 cut(s) 494
TspDTI ATGAA 2 cut(s) 443, 612
TspGWI ACGGA 1 cut(s) 495
VpaK11BI GGWCC 2 cut(s) 93, 205
XapI RAATTY 3 cut(s) 221, 450, 617
XmnI GAANNNNTTC 1 cut(s) 572
XspI CTAG 3 cut(s) 447, 515, 614
Zsp2I ATGCAT 1 cut(s) 472
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.