RLG00000014188

disease resistance protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
Physical Location & Seq
Forward (+)
48920712 .. 48921121
410 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000014188

Sequence Viewer

Length: 336 bp
ATGAACTCAATGCGGTTTGCTCTTGTCATTTCACTAGATAACTTGACCAAAGCGGCTAATGACAAGAAAAAGACAATGAAACTGAGGAAGGGAAAAGGAAAAAAGGTGAAGAAGAATCAGGATTTGGATGATCCCTCTAATGCCGATGGTTTTGATGAATTAAATGAAGAAGTATCACAAGTATTGCCAGATTTCCTGCACAAGATAAAAGCACTGCGTACTTTGACGATTGGGAATTGTTCAATTCTGGAACAAGAATATGGAAAATGCTTAGGGAAGGAGTGGCACAACATTTCTCACATCCTAAACCTCACAATTGGATATTCAGAAGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

12.56

Weight (kDa)

8.52

Isoelectric Point (pI)

34.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 13, 53
AclWI GGATC 1 cut(s) 125
AfaI GTAC 1 cut(s) 220
AgsI TTSAA 1 cut(s) 243
AjuI GAANNNNNNNTTGG 2 cut(s) 107, 139
AlwI GGATC 1 cut(s) 125
AsuHPI GGTGA 1 cut(s) 118
BccI CCATC 1 cut(s) 140
BfaI CTAG 2 cut(s) 35, 334
BisI GCNGC 1 cut(s) 54
BlsI GCNGC 1 cut(s) 55
Bpu10I CCTNAGC 1 cut(s) 271
BseGI GGATG 2 cut(s) 133, 300
BseMII CTCAG 1 cut(s) 74
BsgI GTGCAG 1 cut(s) 182
Bsp143I GATC 1 cut(s) 130
BspACI CCGC 2 cut(s) 13, 53
BspCNI CTCAG 1 cut(s) 75
BspPI GGATC 1 cut(s) 125
BssMI GATC 1 cut(s) 130
BstDEI CTNAG 2 cut(s) 83, 271
BstF5I GGATG 2 cut(s) 133, 300
BstKTI GATC 1 cut(s) 133
BstMBI GATC 1 cut(s) 130
BtsCI GGATG 2 cut(s) 133, 300
BtsI GCAGTG 1 cut(s) 212
BtsIMutI CAGTG 1 cut(s) 212
Csp6I GTAC 1 cut(s) 219
CviJI RGCY 1 cut(s) 56
CviKI_1 RGCY 1 cut(s) 56
CviQI GTAC 1 cut(s) 219
DdeI CTNAG 2 cut(s) 83, 271
DpnI GATC 1 cut(s) 132
DpnII GATC 1 cut(s) 130
FaiI YATR 1 cut(s) 261
Fnu4HI GCNGC 1 cut(s) 54
FokI GGATG 2 cut(s) 140, 287
Fsp4HI GCNGC 1 cut(s) 54
FspBI CTAG 2 cut(s) 35, 334
GluI GCNGC 1 cut(s) 54
HinfI GANTC 1 cut(s) 115
HphI GGTGA 1 cut(s) 118
Hpy188I TCNGA 1 cut(s) 328
Hpy188III TCNNGA 2 cut(s) 119, 248
HpyAV CCTTC 2 cut(s) 82, 271
HpyCH4V TGCA 1 cut(s) 199
HpyF3I CTNAG 2 cut(s) 83, 271
Kzo9I GATC 1 cut(s) 130
LpnPI CCDG 4 cut(s) 104, 201, 209, 233
MaeI CTAG 2 cut(s) 35, 334
MalI GATC 1 cut(s) 132
MboI GATC 1 cut(s) 130
MboII GAAGA 3 cut(s) 121, 124, 179
MfeI CAATTG 1 cut(s) 315
MluCI AATT 4 cut(s) 158, 235, 243, 315
MnlI CCTC 3 cut(s) 78, 145, 320
MseI TTAA 1 cut(s) 161
MunI CAATTG 1 cut(s) 315
NdeII GATC 1 cut(s) 130
PfeI GAWTC 1 cut(s) 115
PkrI GCNGC 1 cut(s) 55
RsaI GTAC 1 cut(s) 220
RsaNI GTAC 1 cut(s) 219
SaqAI TTAA 1 cut(s) 161
SatI GCNGC 1 cut(s) 54
Sau3AI GATC 1 cut(s) 130
SetI ASST 2 cut(s) 108, 312
Sse9I AATT 4 cut(s) 158, 235, 243, 315
SsiI CCGC 2 cut(s) 13, 53
SspMI CTAG 2 cut(s) 35, 334
TasI AATT 4 cut(s) 158, 235, 243, 315
TauI GCSGC 1 cut(s) 56
TfiI GAWTC 1 cut(s) 115
Tru1I TTAA 1 cut(s) 161
Tru9I TTAA 1 cut(s) 161
TscAI CASTG 1 cut(s) 219
TspDTI ATGAA 4 cut(s) 17, 92, 171, 180
TspRI CASTG 1 cut(s) 219
XspI CTAG 2 cut(s) 35, 334
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.