Rh6AG080600

Ribosomal RNA-processing protein 7 (RRP7)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
11732858 .. 11733307
450 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG080600.1

Sequence Viewer

Length: 159 bp
ATGGGAGTCAAGGACAAGAAGAAGAACAAGGAGCTTGCCCAGAGAAATTTGGAGCCTGTTGAAAAGGATAAAAGTTCAGGACCTTCAGAGATGAGAAAGAGAAAAAGAGAGAAGAAAACAATGGTGATTCGAGAAAAGTTGTTCAGATCTCTATTGAAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

53

Amino Acids

6.33

Weight (kDa)

10.49

Isoelectric Point (pI)

47.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 46
AcuI CTGAAG 1 cut(s) 69
AgsI TTSAA 2 cut(s) 62, 157
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
ApoI RAATTY 1 cut(s) 46
AspS9I GGNCC 1 cut(s) 80
AsuHPI GGTGA 1 cut(s) 136
AvaII GGWCC 1 cut(s) 80
BglII AGATCT 1 cut(s) 146
Bme18I GGWCC 1 cut(s) 80
BmgT120I GGNCC 1 cut(s) 80
BmiI GGNNCC 1 cut(s) 54
Bsp143I GATC 1 cut(s) 146
BspLI GGNNCC 1 cut(s) 54
BssMI GATC 1 cut(s) 146
BstC8I GCNNGC 1 cut(s) 36
BstKTI GATC 1 cut(s) 149
BstMBI GATC 1 cut(s) 146
BstX2I RGATCY 1 cut(s) 146
BstYI RGATCY 1 cut(s) 146
Cac8I GCNNGC 1 cut(s) 36
Cfr13I GGNCC 1 cut(s) 80
CviJI RGCY 2 cut(s) 34, 55
CviKI_1 RGCY 2 cut(s) 34, 55
DpnI GATC 1 cut(s) 148
DpnII GATC 1 cut(s) 146
Eco47I GGWCC 1 cut(s) 80
Eco57I CTGAAG 1 cut(s) 69
EcoO109I RGGNCCY 1 cut(s) 80
FspEI CC 9 cut(s) 14, 35, 50, 52, 53, 63, 69, 96, 107
HinfI GANTC 2 cut(s) 6, 127
HphI GGTGA 1 cut(s) 136
Hpy188I TCNGA 2 cut(s) 88, 146
Hpy188III TCNNGA 2 cut(s) 78, 131
HpyAV CCTTC 1 cut(s) 93
Kzo9I GATC 1 cut(s) 146
LmnI GCTCC 2 cut(s) 31, 52
LpnPI CCDG 3 cut(s) 53, 63, 69
MalI GATC 1 cut(s) 148
MboI GATC 1 cut(s) 146
MboII GAAGA 3 cut(s) 31, 34, 124
MflI RGATCY 1 cut(s) 146
MluCI AATT 1 cut(s) 46
MlyI GAGTC 1 cut(s) 15
NdeII GATC 1 cut(s) 146
NlaIV GGNNCC 1 cut(s) 54
PfeI GAWTC 1 cut(s) 127
PleI GAGTC 1 cut(s) 14
PpsI GAGTC 1 cut(s) 14
PpuMI RGGWCCY 1 cut(s) 80
Psp5II RGGWCCY 1 cut(s) 80
PspN4I GGNNCC 1 cut(s) 54
PspPI GGNCC 1 cut(s) 80
PspPPI RGGWCCY 1 cut(s) 80
PsuI RGATCY 1 cut(s) 146
Sau3AI GATC 1 cut(s) 146
Sau96I GGNCC 1 cut(s) 80
SchI GAGTC 1 cut(s) 15
SetI ASST 2 cut(s) 36, 85
SgeI CNNG 8 cut(s) 22, 28, 40, 47, 52, 68, 90, 143
SinI GGWCC 1 cut(s) 80
Sse9I AATT 1 cut(s) 46
TaqI TCGA 1 cut(s) 130
TasI AATT 1 cut(s) 46
TfiI GAWTC 1 cut(s) 127
VpaK11BI GGWCC 1 cut(s) 80
XapI RAATTY 1 cut(s) 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.