Rh6CG040800

Ribosomal RNA-processing protein 7 (RRP7)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
3949906 .. 3950412
507 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG040800.1

Sequence Viewer

Length: 216 bp
ATGGGAGTCAAGGACAAGAAGAAGAACAAGGAGCTTGCCCAGAGAAATTTGGAGCCTGTTGAAAAGGATAAAAGTTCAGGACCTTCAGAGATGAGAAAGAGAAAGAGAGAGAAGAAAACAATGGTGATTCGAGAAAAGTTGTTCAGATCTGGTGATTTGGATGATCCCTCTAATACAGATGGATTGTGGAATACCAGCAAAATAGACCTGGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

8.25

Weight (kDa)

9.64

Isoelectric Point (pI)

43.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 158
AcsI RAATTY 1 cut(s) 46
AcuI CTGAAG 1 cut(s) 69
AgsI TTSAA 1 cut(s) 62
AjnI CCWGG 1 cut(s) 207
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
AlwI GGATC 1 cut(s) 158
ApoI RAATTY 1 cut(s) 46
AspS9I GGNCC 1 cut(s) 80
AsuHPI GGTGA 2 cut(s) 136, 164
AvaII GGWCC 1 cut(s) 80
BccI CCATC 1 cut(s) 173
BciT130I CCWGG 1 cut(s) 209
BglII AGATCT 1 cut(s) 146
Bme1390I CCNGG 1 cut(s) 209
Bme18I GGWCC 1 cut(s) 80
BmgT120I GGNCC 1 cut(s) 80
BmiI GGNNCC 1 cut(s) 54
BmrFI CCNGG 1 cut(s) 209
BseBI CCWGG 1 cut(s) 209
BseGI GGATG 1 cut(s) 166
Bsp143I GATC 2 cut(s) 146, 163
BspLI GGNNCC 1 cut(s) 54
BspPI GGATC 1 cut(s) 158
BssMI GATC 2 cut(s) 146, 163
Bst2UI CCWGG 1 cut(s) 209
BstC8I GCNNGC 1 cut(s) 36
BstF5I GGATG 1 cut(s) 166
BstKTI GATC 2 cut(s) 149, 166
BstMBI GATC 2 cut(s) 146, 163
BstNI CCWGG 1 cut(s) 209
BstSCI CCNGG 1 cut(s) 207
BstX2I RGATCY 1 cut(s) 146
BstYI RGATCY 1 cut(s) 146
BtsCI GGATG 1 cut(s) 166
Cac8I GCNNGC 1 cut(s) 36
Cfr13I GGNCC 1 cut(s) 80
CviJI RGCY 2 cut(s) 34, 55
CviKI_1 RGCY 2 cut(s) 34, 55
DpnI GATC 2 cut(s) 148, 165
DpnII GATC 2 cut(s) 146, 163
Eco47I GGWCC 1 cut(s) 80
Eco57I CTGAAG 1 cut(s) 69
EcoO109I RGGNCCY 1 cut(s) 80
EcoRII CCWGG 1 cut(s) 207
FokI GGATG 1 cut(s) 173
HinfI GANTC 2 cut(s) 6, 127
HphI GGTGA 2 cut(s) 136, 164
Hpy188I TCNGA 2 cut(s) 88, 146
Hpy188III TCNNGA 2 cut(s) 78, 131
HpyAV CCTTC 1 cut(s) 93
Kzo9I GATC 2 cut(s) 146, 163
LmnI GCTCC 2 cut(s) 31, 52
LpnPI CCDG 6 cut(s) 53, 63, 69, 135, 194, 208
MalI GATC 2 cut(s) 148, 165
MboI GATC 2 cut(s) 146, 163
MboII GAAGA 3 cut(s) 31, 34, 124
MflI RGATCY 1 cut(s) 146
MluCI AATT 1 cut(s) 46
MlyI GAGTC 1 cut(s) 15
MnlI CCTC 1 cut(s) 178
MspR9I CCNGG 1 cut(s) 209
MvaI CCWGG 1 cut(s) 209
NdeII GATC 2 cut(s) 146, 163
NlaIV GGNNCC 1 cut(s) 54
PfeI GAWTC 1 cut(s) 127
PleI GAGTC 1 cut(s) 14
PpsI GAGTC 1 cut(s) 14
PpuMI RGGWCCY 1 cut(s) 80
Psp5II RGGWCCY 1 cut(s) 80
Psp6I CCWGG 1 cut(s) 207
PspGI CCWGG 1 cut(s) 207
PspN4I GGNNCC 1 cut(s) 54
PspPI GGNCC 1 cut(s) 80
PspPPI RGGWCCY 1 cut(s) 80
PsuI RGATCY 1 cut(s) 146
Sau3AI GATC 2 cut(s) 146, 163
Sau96I GGNCC 1 cut(s) 80
SchI GAGTC 1 cut(s) 15
ScrFI CCNGG 1 cut(s) 209
SetI ASST 3 cut(s) 36, 85, 210
SinI GGWCC 1 cut(s) 80
Sse9I AATT 1 cut(s) 46
StyD4I CCNGG 1 cut(s) 207
TaqI TCGA 1 cut(s) 130
TasI AATT 1 cut(s) 46
TfiI GAWTC 1 cut(s) 127
VpaK11BI GGWCC 1 cut(s) 80
XapI RAATTY 1 cut(s) 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.