Rmu_sc0002577.1_g000001

Ribosome production factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002577.1
Physical Location & Seq
Reverse (-)
3548 .. 5264
1717 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002577.1_g000001.1.cds

Sequence Viewer

Length: 417 bp
atgggagtcaaggacaagaagaagaacaaggagcttgcccagagaaatttggagcctgttgaaaaggataactcgaccaaagcggcgaatgacaagaaaaagacaaagaaactgaggaaaggaaaaggaaagaaggtgaagaacaatcaggatttggatgatccctctaataccaatgccgcagatgatcagagccaattcgaagttcagggagagactgcaggaagtgctgaaatgaggggtccttcttttatagaggaactactttcggtgatcccaaatgcgcagtactataaaagaggcacttatgacttgaaaaagattatagagtatgcaaataaaaaggaattcacttctttaattgttgttcataccaatcgccgggaaccaggttggtctctcagactttccttctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

138

Amino Acids

15.7

Weight (kDa)

9.65

Isoelectric Point (pI)

34.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 285
AciI CCGC 2 cut(s) 83, 180
AclWI GGATC 2 cut(s) 155, 268
AcsI RAATTY 2 cut(s) 46, 347
AfaI GTAC 1 cut(s) 290
AfiI CCNNNNNNNGG 1 cut(s) 381
AgsI TTSAA 2 cut(s) 62, 316
AjnI CCWGG 1 cut(s) 388
AjuI GAANNNNNNNTTGG 2 cut(s) 189, 221
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
Alw26I GTCTC 2 cut(s) 209, 402
AlwI GGATC 2 cut(s) 155, 268
ApoI RAATTY 2 cut(s) 46, 347
AspLEI GCGC 1 cut(s) 286
AspS9I GGNCC 1 cut(s) 242
AsuC2I CCSGG 1 cut(s) 383
AsuHPI GGTGA 2 cut(s) 148, 283
AsuII TTCGAA 1 cut(s) 201
AvaII GGWCC 1 cut(s) 242
BciT130I CCWGG 1 cut(s) 390
BclI TGATCA 1 cut(s) 187
BcnI CCSGG 1 cut(s) 383
BcoDI GTCTC 2 cut(s) 209, 402
BfmI CTRYAG 1 cut(s) 219
BisI GCNGC 2 cut(s) 84, 180
BlsI GCNGC 2 cut(s) 85, 181
BmcAI AGTACT 1 cut(s) 290
Bme1390I CCNGG 2 cut(s) 383, 390
Bme18I GGWCC 1 cut(s) 242
BmgT120I GGNCC 1 cut(s) 242
BmiI GGNNCC 3 cut(s) 54, 243, 387
BmrFI CCNGG 2 cut(s) 383, 390
Bpu14I TTCGAA 1 cut(s) 201
BpuMI CCSGG 1 cut(s) 383
BsaI GGTCTC 1 cut(s) 402
Bsc4I CCNNNNNNNGG 1 cut(s) 381
BseBI CCWGG 1 cut(s) 390
BseGI GGATG 1 cut(s) 163
BseLI CCNNNNNNNGG 1 cut(s) 381
BseMII CTCAG 2 cut(s) 104, 415
BsiSI CCGG 1 cut(s) 382
BslI CCNNNNNNNGG 1 cut(s) 381
BsmAI GTCTC 2 cut(s) 209, 402
Bso31I GGTCTC 1 cut(s) 402
Bsp119I TTCGAA 1 cut(s) 201
Bsp143I GATC 3 cut(s) 160, 187, 273
BspACI CCGC 2 cut(s) 83, 180
BspCNI CTCAG 2 cut(s) 105, 414
BspLI GGNNCC 3 cut(s) 54, 243, 387
BspMAI CTGCAG 1 cut(s) 223
BspPI GGATC 2 cut(s) 155, 268
BspT104I TTCGAA 1 cut(s) 201
BspTNI GGTCTC 1 cut(s) 402
BssMI GATC 3 cut(s) 160, 187, 273
Bst2UI CCWGG 1 cut(s) 390
BstAPI GCANNNNNTGC 1 cut(s) 227
BstBI TTCGAA 1 cut(s) 201
BstC8I GCNNGC 1 cut(s) 36
BstDEI CTNAG 2 cut(s) 113, 401
BstF5I GGATG 1 cut(s) 163
BstHHI GCGC 1 cut(s) 286
BstKTI GATC 3 cut(s) 163, 190, 276
BstMAI GTCTC 2 cut(s) 209, 402
BstMBI GATC 3 cut(s) 160, 187, 273
BstMWI GCNNNNNNNGC 1 cut(s) 227
BstNI CCWGG 1 cut(s) 390
BstSCI CCNGG 2 cut(s) 381, 388
BstSFI CTRYAG 1 cut(s) 219
BtsCI GGATG 1 cut(s) 163
Cac8I GCNNGC 1 cut(s) 36
CfoI GCGC 1 cut(s) 286
Cfr13I GGNCC 1 cut(s) 242
CsiI ACCWGGT 1 cut(s) 388
Csp6I GTAC 1 cut(s) 289
CviJI RGCY 3 cut(s) 34, 55, 195
CviKI_1 RGCY 3 cut(s) 34, 55, 195
CviQI GTAC 1 cut(s) 289
DdeI CTNAG 2 cut(s) 113, 401
DpnI GATC 3 cut(s) 162, 189, 275
DpnII GATC 3 cut(s) 160, 187, 273
Eco31I GGTCTC 1 cut(s) 402
Eco47I GGWCC 1 cut(s) 242
EcoO109I RGGNCCY 1 cut(s) 242
EcoRI GAATTC 1 cut(s) 347
EcoRII CCWGG 1 cut(s) 388
FaiI YATR 6 cut(s) 254, 294, 309, 326, 333, 372
FalI AAGNNNNNCTT 2 cut(s) 289, 321
FbaI TGATCA 1 cut(s) 187
Fnu4HI GCNGC 2 cut(s) 84, 180
FokI GGATG 1 cut(s) 170
Fsp4HI GCNGC 2 cut(s) 84, 180
FspI TGCGCA 1 cut(s) 285
GlaI GCGC 1 cut(s) 285
GluI GCNGC 2 cut(s) 84, 180
HapII CCGG 1 cut(s) 382
HhaI GCGC 1 cut(s) 286
Hin6I GCGC 1 cut(s) 284
HinP1I GCGC 1 cut(s) 284
HinfI GANTC 1 cut(s) 6
HpaII CCGG 1 cut(s) 382
HphI GGTGA 2 cut(s) 148, 283
Hpy188I TCNGA 3 cut(s) 192, 404, 416
Hpy188III TCNNGA 1 cut(s) 149
HpyAV CCTTC 2 cut(s) 127, 255
HpyCH4V TGCA 2 cut(s) 221, 335
HpyF10VI GCNNNNNNNGC 1 cut(s) 227
HpyF3I CTNAG 2 cut(s) 113, 401
HspAI GCGC 1 cut(s) 284
Ksp22I TGATCA 1 cut(s) 187
Kzo9I GATC 3 cut(s) 160, 187, 273
LmnI GCTCC 2 cut(s) 31, 52
LpnPI CCDG 8 cut(s) 53, 69, 134, 194, 207, 375, 395, 402
MabI ACCWGGT 1 cut(s) 388
MalI GATC 3 cut(s) 162, 189, 275
MboI GATC 3 cut(s) 160, 187, 273
MboII GAAGA 3 cut(s) 31, 34, 151
MluCI AATT 4 cut(s) 46, 197, 347, 360
MlyI GAGTC 1 cut(s) 15
MnlI CCTC 5 cut(s) 108, 175, 231, 250, 293
MseI TTAA 1 cut(s) 359
MspI CCGG 1 cut(s) 382
MspR9I CCNGG 2 cut(s) 383, 390
MvaI CCWGG 1 cut(s) 390
MwoI GCNNNNNNNGC 1 cut(s) 227
NciI CCSGG 1 cut(s) 383
NdeII GATC 3 cut(s) 160, 187, 273
NlaIV GGNNCC 3 cut(s) 54, 243, 387
NsbI TGCGCA 1 cut(s) 285
NspV TTCGAA 1 cut(s) 201
PkrI GCNGC 2 cut(s) 85, 181
PleI GAGTC 1 cut(s) 14
PpsI GAGTC 1 cut(s) 14
PpuMI RGGWCCY 1 cut(s) 242
Psp5II RGGWCCY 1 cut(s) 242
Psp6I CCWGG 1 cut(s) 388
PspGI CCWGG 1 cut(s) 388
PspN4I GGNNCC 3 cut(s) 54, 243, 387
PspPI GGNCC 1 cut(s) 242
PspPPI RGGWCCY 1 cut(s) 242
PstI CTGCAG 1 cut(s) 223
RsaI GTAC 1 cut(s) 290
RsaNI GTAC 1 cut(s) 289
SaqAI TTAA 1 cut(s) 359
SatI GCNGC 2 cut(s) 84, 180
Sau3AI GATC 3 cut(s) 160, 187, 273
Sau96I GGNCC 1 cut(s) 242
ScaI AGTACT 1 cut(s) 290
SchI GAGTC 1 cut(s) 15
ScrFI CCNGG 2 cut(s) 383, 390
SetI ASST 3 cut(s) 36, 138, 394
SexAI ACCWGGT 1 cut(s) 388
SfcI CTRYAG 1 cut(s) 219
SfuI TTCGAA 1 cut(s) 201
SinI GGWCC 1 cut(s) 242
Sse9I AATT 4 cut(s) 46, 197, 347, 360
SsiI CCGC 2 cut(s) 83, 180
StyD4I CCNGG 2 cut(s) 381, 388
TaqI TCGA 2 cut(s) 74, 201
TasI AATT 4 cut(s) 46, 197, 347, 360
TatI WGTACW 1 cut(s) 288
TauI GCSGC 2 cut(s) 86, 182
Tru1I TTAA 1 cut(s) 359
Tru9I TTAA 1 cut(s) 359
TspDTI ATGAA 1 cut(s) 359
VpaK11BI GGWCC 1 cut(s) 242
XapI RAATTY 2 cut(s) 46, 347
ZrmI AGTACT 1 cut(s) 290
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.