Rh6DG018800

Ribosomal RNA-processing protein 7 (RRP7)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
1719069 .. 1719496
428 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG018800.1

Sequence Viewer

Length: 228 bp
ATGCCTCCCACCAAAGCTACAAGTAAGTCAAAGAAAGCTAGGAAAAAGAAAAAGAAGAATCACGATTCCTTCGAAGGTGGGAAGTTACTGGAAAAGAGAGTGGAAGCTGTTCGAGATGAACCTTGTCATCTCTCTTCAGTGGATGTGGACTGCTCAAGAGAAATAACAAGTATAATTCTTGAATTGAAACATCGTTATATAGTGATGTTCTATCTGCATAAATATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.77

Weight (kDa)

9.7

Isoelectric Point (pI)

41.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 120
AgsI TTSAA 2 cut(s) 182, 187
AluBI AGCT 3 cut(s) 17, 38, 107
AluI AGCT 3 cut(s) 17, 38, 107
Asp700I GAANNNNTTC 1 cut(s) 108
AsuII TTCGAA 1 cut(s) 72
BfaI CTAG 1 cut(s) 39
Bpu14I TTCGAA 1 cut(s) 72
BpuEI CTTGAG 1 cut(s) 139
Bse1I ACTGG 1 cut(s) 93
BseGI GGATG 1 cut(s) 148
BseNI ACTGG 1 cut(s) 93
Bsp119I TTCGAA 1 cut(s) 72
BspT104I TTCGAA 1 cut(s) 72
BsrI ACTGG 1 cut(s) 93
Bst6I CTCTTC 1 cut(s) 139
BstBI TTCGAA 1 cut(s) 72
BstF5I GGATG 1 cut(s) 148
BtsCI GGATG 1 cut(s) 148
BtsIMutI CAGTG 1 cut(s) 144
CviJI RGCY 3 cut(s) 17, 38, 107
CviKI_1 RGCY 3 cut(s) 17, 38, 107
Eam1104I CTCTTC 1 cut(s) 139
EarI CTCTTC 1 cut(s) 139
Eco57I CTGAAG 1 cut(s) 120
FaiI YATR 4 cut(s) 173, 198, 200, 219
FokI GGATG 1 cut(s) 155
FspBI CTAG 1 cut(s) 39
HinfI GANTC 2 cut(s) 58, 65
Hpy166II GTNNAC 1 cut(s) 148
Hpy188III TCNNGA 4 cut(s) 62, 113, 156, 179
Hpy8I GTNNAC 1 cut(s) 148
HpyAV CCTTC 2 cut(s) 68, 79
HpyCH4V TGCA 1 cut(s) 217
LpnPI CCDG 1 cut(s) 74
MaeI CTAG 1 cut(s) 39
MaeIII GTNAC 1 cut(s) 84
MboII GAAGA 2 cut(s) 67, 126
MluCI AATT 2 cut(s) 174, 182
MnlI CCTC 1 cut(s) 15
MroXI GAANNNNTTC 1 cut(s) 108
NspV TTCGAA 1 cut(s) 72
PcsI WCGNNNNNNNCGW 1 cut(s) 69
PdmI GAANNNNTTC 1 cut(s) 108
PfeI GAWTC 2 cut(s) 58, 65
SetI ASST 5 cut(s) 19, 40, 79, 109, 124
SfuI TTCGAA 1 cut(s) 72
SgeI CNNG 9 cut(s) 33, 51, 74, 101, 125, 135, 168, 180, 191
SmlI CTYRAG 1 cut(s) 154
SmoI CTYRAG 1 cut(s) 154
Sse9I AATT 2 cut(s) 174, 182
SspI AATATT 1 cut(s) 224
SspMI CTAG 1 cut(s) 39
TaqI TCGA 2 cut(s) 72, 112
TasI AATT 2 cut(s) 174, 182
TfiI GAWTC 2 cut(s) 58, 65
TscAI CASTG 1 cut(s) 144
TspDTI ATGAA 1 cut(s) 132
TspRI CASTG 1 cut(s) 144
XmnI GAANNNNTTC 1 cut(s) 108
XspI CTAG 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.