Rh6CG095900

Ribosome production factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
10574611 .. 10576662
2052 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG095900.1

Sequence Viewer

Length: 336 bp
ATGGGAGTCAAGGACAAGAAGAAGAACAAGGAGCTTGCCCAGAGAAATTTGGAGCCTGTTGAAAAAGATAAAAGTTCAGGACCTTCAGAGATGAGAAAGAGAAAAAGAGAGAAGAAAACAATGGTGATTCAAGAAAAGTTGTTCAGATCTCTATTGAAGAGGGGTCTTGCTTTTATAGAGGAACTACTTTTGGTGATCCCAACTGCGCAGTACTATAAAAGAGGCACTTATGACCTGAAAAAGATTATAGAGTATGCAAATAAAAAAGAATTCACTTCTTTAATTGTTGTTCATTCCAATCGCCAGGAACCAGTTGGTGAAAAGAGGAGTCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

111

Amino Acids

13.07

Weight (kDa)

10.03

Isoelectric Point (pI)

60.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 207
AclWI GGATC 1 cut(s) 190
AcsI RAATTY 2 cut(s) 46, 269
AcuI CTGAAG 1 cut(s) 69
AfaI GTAC 1 cut(s) 212
AgsI TTSAA 3 cut(s) 62, 131, 157
AjnI CCWGG 1 cut(s) 303
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
AlwI GGATC 1 cut(s) 190
ApoI RAATTY 2 cut(s) 46, 269
AspLEI GCGC 1 cut(s) 208
AspS9I GGNCC 1 cut(s) 80
AsuHPI GGTGA 3 cut(s) 136, 205, 329
AvaII GGWCC 1 cut(s) 80
BciT130I CCWGG 1 cut(s) 305
BglII AGATCT 1 cut(s) 146
BmcAI AGTACT 1 cut(s) 212
Bme1390I CCNGG 1 cut(s) 305
Bme18I GGWCC 1 cut(s) 80
BmgT120I GGNCC 1 cut(s) 80
BmiI GGNNCC 2 cut(s) 54, 309
BmrFI CCNGG 1 cut(s) 305
Bse1I ACTGG 1 cut(s) 311
BseBI CCWGG 1 cut(s) 305
BseNI ACTGG 1 cut(s) 311
Bsp143I GATC 2 cut(s) 146, 195
BspLI GGNNCC 2 cut(s) 54, 309
BspPI GGATC 1 cut(s) 190
BsrI ACTGG 1 cut(s) 311
BssMI GATC 2 cut(s) 146, 195
Bst2UI CCWGG 1 cut(s) 305
Bst6I CTCTTC 1 cut(s) 152
BstC8I GCNNGC 1 cut(s) 36
BstHHI GCGC 1 cut(s) 208
BstKTI GATC 2 cut(s) 149, 198
BstMBI GATC 2 cut(s) 146, 195
BstNI CCWGG 1 cut(s) 305
BstSCI CCNGG 1 cut(s) 303
BstX2I RGATCY 1 cut(s) 146
BstYI RGATCY 1 cut(s) 146
Cac8I GCNNGC 1 cut(s) 36
CfoI GCGC 1 cut(s) 208
Cfr13I GGNCC 1 cut(s) 80
Csp6I GTAC 1 cut(s) 211
CviJI RGCY 2 cut(s) 34, 55
CviKI_1 RGCY 2 cut(s) 34, 55
CviQI GTAC 1 cut(s) 211
DpnI GATC 2 cut(s) 148, 197
DpnII GATC 2 cut(s) 146, 195
Eam1104I CTCTTC 1 cut(s) 152
EarI CTCTTC 1 cut(s) 152
Eco47I GGWCC 1 cut(s) 80
Eco57I CTGAAG 1 cut(s) 69
EcoO109I RGGNCCY 1 cut(s) 80
EcoRI GAATTC 1 cut(s) 269
EcoRII CCWGG 1 cut(s) 303
FaiI YATR 5 cut(s) 176, 216, 231, 248, 255
FalI AAGNNNNNCTT 2 cut(s) 211, 243
FspI TGCGCA 1 cut(s) 207
GlaI GCGC 1 cut(s) 207
HhaI GCGC 1 cut(s) 208
Hin6I GCGC 1 cut(s) 206
HinP1I GCGC 1 cut(s) 206
HinfI GANTC 3 cut(s) 6, 127, 328
HphI GGTGA 3 cut(s) 136, 205, 329
Hpy188I TCNGA 2 cut(s) 88, 146
Hpy188III TCNNGA 2 cut(s) 78, 131
HpyAV CCTTC 1 cut(s) 93
HpyCH4V TGCA 1 cut(s) 257
HspAI GCGC 1 cut(s) 206
Kzo9I GATC 2 cut(s) 146, 195
LmnI GCTCC 2 cut(s) 31, 52
LpnPI CCDG 7 cut(s) 53, 63, 69, 248, 290, 317, 324
MalI GATC 2 cut(s) 148, 197
MboI GATC 2 cut(s) 146, 195
MboII GAAGA 4 cut(s) 31, 34, 124, 169
MflI RGATCY 1 cut(s) 146
MluCI AATT 3 cut(s) 46, 269, 282
MlyI GAGTC 1 cut(s) 15
MnlI CCTC 4 cut(s) 153, 172, 215, 318
MseI TTAA 1 cut(s) 281
MspR9I CCNGG 1 cut(s) 305
MvaI CCWGG 1 cut(s) 305
NdeII GATC 2 cut(s) 146, 195
NlaIV GGNNCC 2 cut(s) 54, 309
NsbI TGCGCA 1 cut(s) 207
PfeI GAWTC 1 cut(s) 127
PleI GAGTC 1 cut(s) 14
PpsI GAGTC 1 cut(s) 14
PpuMI RGGWCCY 1 cut(s) 80
Psp5II RGGWCCY 1 cut(s) 80
Psp6I CCWGG 1 cut(s) 303
PspGI CCWGG 1 cut(s) 303
PspN4I GGNNCC 2 cut(s) 54, 309
PspPI GGNCC 1 cut(s) 80
PspPPI RGGWCCY 1 cut(s) 80
PsuI RGATCY 1 cut(s) 146
RsaI GTAC 1 cut(s) 212
RsaNI GTAC 1 cut(s) 211
SaqAI TTAA 1 cut(s) 281
Sau3AI GATC 2 cut(s) 146, 195
Sau96I GGNCC 1 cut(s) 80
ScaI AGTACT 1 cut(s) 212
SchI GAGTC 1 cut(s) 15
ScrFI CCNGG 1 cut(s) 305
SetI ASST 3 cut(s) 36, 85, 237
SinI GGWCC 1 cut(s) 80
Sse9I AATT 3 cut(s) 46, 269, 282
StyD4I CCNGG 1 cut(s) 303
TasI AATT 3 cut(s) 46, 269, 282
TatI WGTACW 1 cut(s) 210
TfiI GAWTC 1 cut(s) 127
Tru1I TTAA 1 cut(s) 281
Tru9I TTAA 1 cut(s) 281
TspDTI ATGAA 1 cut(s) 281
VpaK11BI GGWCC 1 cut(s) 80
XapI RAATTY 2 cut(s) 46, 269
XcmI CCANNNNNNNNNTGG 1 cut(s) 311
ZrmI AGTACT 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.