RLG00000024336

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
Physical Location & Seq
Forward (+)
34860139 .. 34860537
399 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000024336

Sequence Viewer

Length: 399 bp
ATGTCCCCACTCTACCGATTAACACCACCAGCAAGTTCTTTCCTCCTCCTCCTCTGGACCTCCACCACCACTACTAGAGATAGAAGGACAATGAGGAAGAAGCAGTCAAGAACAATGAACAGAAAAAGAAATCGGAGTTGCCCAAAGTCAATTCAACACAATGCCCAAGAAATCGGACCAGATGAAGGTGGAGGAGAAAGGGATGGGTCCGGTGGGAAGCTGGTGAGGTCGTCTGTTGAGTTGGTCAAGACTGTGGAGGCCAAAGTTTCGGTTGTTTACACAATTGCACGTACTCAATCTCTAGCCCGAAGTTACGTCGCCAACCACGATTCAAAGCCAGCAATCTGTTACCCAATTTGCCAGATTGAGAAAATATTAGAACTGTACATTAATGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

133

Amino Acids

14.88

Weight (kDa)

9.9

Isoelectric Point (pI)

61.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 292, 386
AfiI CCNNNNNNNGG 1 cut(s) 185
AgsI TTSAA 2 cut(s) 155, 333
AluBI AGCT 1 cut(s) 220
AluI AGCT 1 cut(s) 220
AoxI GGCC 1 cut(s) 258
AseI ATTAAT 1 cut(s) 390
AspS9I GGNCC 3 cut(s) 57, 176, 207
AsuHPI GGTGA 1 cut(s) 235
AvaII GGWCC 3 cut(s) 57, 176, 207
BccI CCATC 1 cut(s) 197
BfaI CTAG 2 cut(s) 75, 302
Bme18I GGWCC 3 cut(s) 57, 176, 207
BmgT120I GGNCC 3 cut(s) 57, 176, 207
BmiI GGNNCC 1 cut(s) 208
BsaAI YACGTR 1 cut(s) 290
BsaWI WCCGGW 1 cut(s) 209
Bsc4I CCNNNNNNNGG 1 cut(s) 185
BseGI GGATG 1 cut(s) 208
BseLI CCNNNNNNNGG 1 cut(s) 185
BseRI GAGGAG 4 cut(s) 35, 38, 41, 207
BshFI GGCC 1 cut(s) 260
BsiSI CCGG 1 cut(s) 210
BslI CCNNNNNNNGG 1 cut(s) 185
BsnI GGCC 1 cut(s) 260
Bsp1407I TGTACA 1 cut(s) 384
BspANI GGCC 1 cut(s) 260
BspLI GGNNCC 1 cut(s) 208
BsrGI TGTACA 1 cut(s) 384
Bst4CI ACNGT 2 cut(s) 253, 384
BstAUI TGTACA 1 cut(s) 384
BstBAI YACGTR 1 cut(s) 290
BstC8I GCNNGC 1 cut(s) 339
BstF5I GGATG 1 cut(s) 208
BsuRI GGCC 1 cut(s) 260
BtsCI GGATG 1 cut(s) 208
Cac8I GCNNGC 1 cut(s) 339
Cfr13I GGNCC 3 cut(s) 57, 176, 207
Csp6I GTAC 2 cut(s) 291, 385
CviJI RGCY 4 cut(s) 220, 260, 305, 337
CviKI_1 RGCY 4 cut(s) 220, 260, 305, 337
CviQI GTAC 2 cut(s) 291, 385
Eco47I GGWCC 3 cut(s) 57, 176, 207
FokI GGATG 1 cut(s) 215
FspBI CTAG 2 cut(s) 75, 302
HaeIII GGCC 1 cut(s) 260
HapII CCGG 1 cut(s) 210
HinfI GANTC 1 cut(s) 329
HpaII CCGG 1 cut(s) 210
HphI GGTGA 1 cut(s) 235
Hpy166II GTNNAC 1 cut(s) 277
Hpy188I TCNGA 2 cut(s) 135, 176
Hpy188III TCNNGA 3 cut(s) 55, 108, 247
Hpy8I GTNNAC 1 cut(s) 277
Hpy99I CGWCG 1 cut(s) 320
HpyAV CCTTC 2 cut(s) 78, 179
HpyCH4III ACNGT 2 cut(s) 253, 384
HpyCH4IV ACGT 2 cut(s) 289, 315
HpyCH4V TGCA 1 cut(s) 287
HpySE526I ACGT 2 cut(s) 289, 315
LpnPI CCDG 7 cut(s) 40, 42, 192, 206, 223, 351, 374
MaeI CTAG 2 cut(s) 75, 302
MaeII ACGT 2 cut(s) 289, 315
MaeIII GTNAC 2 cut(s) 311, 347
MboII GAAGA 1 cut(s) 109
MfeI CAATTG 1 cut(s) 282
MluCI AATT 3 cut(s) 150, 282, 354
MnlI CCTC 9 cut(s) 53, 56, 59, 62, 70, 87, 185, 219, 250
MseI TTAA 2 cut(s) 20, 390
MspI CCGG 1 cut(s) 210
MunI CAATTG 1 cut(s) 282
NlaIV GGNNCC 1 cut(s) 208
PcsI WCGNNNNNNNCGW 1 cut(s) 324
PfeI GAWTC 1 cut(s) 329
Ppu21I YACGTR 1 cut(s) 290
PshBI ATTAAT 1 cut(s) 390
PspN4I GGNNCC 1 cut(s) 208
PspPI GGNCC 3 cut(s) 57, 176, 207
RsaI GTAC 2 cut(s) 292, 386
RsaNI GTAC 2 cut(s) 291, 385
SaqAI TTAA 2 cut(s) 20, 390
Sau96I GGNCC 3 cut(s) 57, 176, 207
SetI ASST 6 cut(s) 62, 190, 222, 230, 292, 318
SinI GGWCC 3 cut(s) 57, 176, 207
Sse9I AATT 3 cut(s) 150, 282, 354
SspI AATATT 1 cut(s) 375
SspMI CTAG 2 cut(s) 75, 302
TaaI ACNGT 2 cut(s) 253, 384
TaiI ACGT 2 cut(s) 292, 318
TasI AATT 3 cut(s) 150, 282, 354
TatI WGTACW 1 cut(s) 384
TfiI GAWTC 1 cut(s) 329
Tru1I TTAA 2 cut(s) 20, 390
Tru9I TTAA 2 cut(s) 20, 390
TspDTI ATGAA 2 cut(s) 131, 198
VpaK11BI GGWCC 3 cut(s) 57, 176, 207
VspI ATTAAT 1 cut(s) 390
XspI CTAG 2 cut(s) 75, 302
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.