Rh6AG204900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
36577980 .. 36578288
309 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG204900.1

Sequence Viewer

Length: 309 bp
ATGTCCCCACTTCACCGATTAACACCAGCAACAATTTTTTTCCTCCTCCTCCTTTGGACATCCACCACCAGTACCAGACATAGAAGGACAATGTGGAAGAAGCAGTCAAGAACAATGAACGGAAAAAGAAATTGGAGCTGCCCAAAGTCAATTCAACATAATGCCCAAGAAATCGGACAGGATGAAGGTGGAGGAGAGAGGGATGGGTCCGGTGGGGAGCTGGTGAGGTCATCTGTTGAGTTGGTCAAGACTGTGGAGACCAAAGTTTTGGTTGGTTACACAATTGGACGTACTCGATCTCTAGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

11.47

Weight (kDa)

10.61

Isoelectric Point (pI)

60.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 73, 292
AgsI TTSAA 1 cut(s) 155
AjuI GAANNNNNNNTTGG 2 cut(s) 115, 147
AluBI AGCT 3 cut(s) 138, 220, 305
AluI AGCT 3 cut(s) 138, 220, 305
Alw26I GTCTC 1 cut(s) 251
ApeKI GCWGC 1 cut(s) 138
ArsI GACNNNNNNTTYG 2 cut(s) 250, 282
AspS9I GGNCC 1 cut(s) 207
AsuHPI GGTGA 2 cut(s) 5, 235
AvaII GGWCC 1 cut(s) 207
BbvI GCAGC 1 cut(s) 125
BccI CCATC 1 cut(s) 197
BcoDI GTCTC 1 cut(s) 251
BfaI CTAG 1 cut(s) 302
BisI GCNGC 1 cut(s) 139
BlsI GCNGC 1 cut(s) 140
Bme18I GGWCC 1 cut(s) 207
BmgT120I GGNCC 1 cut(s) 207
BmiI GGNNCC 1 cut(s) 208
BsaI GGTCTC 1 cut(s) 251
BsaWI WCCGGW 1 cut(s) 209
Bse1I ACTGG 1 cut(s) 69
BseGI GGATG 3 cut(s) 59, 187, 208
BseNI ACTGG 1 cut(s) 69
BseRI GAGGAG 3 cut(s) 35, 38, 207
BseXI GCAGC 1 cut(s) 125
BsiSI CCGG 1 cut(s) 210
BsmAI GTCTC 1 cut(s) 251
Bso31I GGTCTC 1 cut(s) 251
Bsp143I GATC 1 cut(s) 296
BspLI GGNNCC 1 cut(s) 208
BspTNI GGTCTC 1 cut(s) 251
BsrI ACTGG 1 cut(s) 69
BssMI GATC 1 cut(s) 296
Bst4CI ACNGT 1 cut(s) 253
BstF5I GGATG 3 cut(s) 59, 187, 208
BstKTI GATC 1 cut(s) 299
BstMAI GTCTC 1 cut(s) 251
BstMBI GATC 1 cut(s) 296
BstV1I GCAGC 1 cut(s) 125
BstXI CCANNNNNNTGG 1 cut(s) 268
BtsCI GGATG 3 cut(s) 59, 187, 208
Cfr13I GGNCC 1 cut(s) 207
Csp6I GTAC 2 cut(s) 72, 291
CviJI RGCY 3 cut(s) 138, 220, 305
CviKI_1 RGCY 3 cut(s) 138, 220, 305
CviQI GTAC 2 cut(s) 72, 291
DpnI GATC 1 cut(s) 298
DpnII GATC 1 cut(s) 296
Eco31I GGTCTC 1 cut(s) 251
Eco47I GGWCC 1 cut(s) 207
FaiI YATR 2 cut(s) 81, 159
Fnu4HI GCNGC 1 cut(s) 139
FokI GGATG 3 cut(s) 46, 194, 215
Fsp4HI GCNGC 1 cut(s) 139
FspBI CTAG 1 cut(s) 302
GluI GCNGC 1 cut(s) 139
HapII CCGG 1 cut(s) 210
HpaII CCGG 1 cut(s) 210
HphI GGTGA 2 cut(s) 5, 235
Hpy188I TCNGA 1 cut(s) 176
Hpy188III TCNNGA 2 cut(s) 108, 247
HpyAV CCTTC 2 cut(s) 78, 179
HpyCH4III ACNGT 1 cut(s) 253
HpyCH4IV ACGT 1 cut(s) 289
HpySE526I ACGT 1 cut(s) 289
Kzo9I GATC 1 cut(s) 296
LmnI GCTCC 2 cut(s) 135, 217
LpnPI CCDG 6 cut(s) 39, 82, 88, 164, 206, 223
Lsp1109I GCAGC 1 cut(s) 125
MaeI CTAG 1 cut(s) 302
MaeII ACGT 1 cut(s) 289
MaeIII GTNAC 1 cut(s) 275
MalI GATC 1 cut(s) 298
MboI GATC 1 cut(s) 296
MboII GAAGA 1 cut(s) 109
MfeI CAATTG 1 cut(s) 282
MluCI AATT 4 cut(s) 33, 130, 150, 282
MnlI CCTC 6 cut(s) 53, 56, 59, 185, 192, 219
MseI TTAA 1 cut(s) 20
MspI CCGG 1 cut(s) 210
MunI CAATTG 1 cut(s) 282
NdeII GATC 1 cut(s) 296
NlaIV GGNNCC 1 cut(s) 208
PkrI GCNGC 1 cut(s) 140
PspN4I GGNNCC 1 cut(s) 208
PspPI GGNCC 1 cut(s) 207
RsaI GTAC 2 cut(s) 73, 292
RsaNI GTAC 2 cut(s) 72, 291
SaqAI TTAA 1 cut(s) 20
SatI GCNGC 1 cut(s) 139
Sau3AI GATC 1 cut(s) 296
Sau96I GGNCC 1 cut(s) 207
SetI ASST 6 cut(s) 140, 190, 222, 230, 292, 307
SgeI CNNG 9 cut(s) 38, 81, 87, 120, 179, 191, 222, 233, 259
SinI GGWCC 1 cut(s) 207
Sse9I AATT 4 cut(s) 33, 130, 150, 282
SspMI CTAG 1 cut(s) 302
TaaI ACNGT 1 cut(s) 253
TaiI ACGT 1 cut(s) 292
TaqI TCGA 1 cut(s) 295
TasI AATT 4 cut(s) 33, 130, 150, 282
Tru1I TTAA 1 cut(s) 20
Tru9I TTAA 1 cut(s) 20
TseI GCWGC 1 cut(s) 138
TspDTI ATGAA 2 cut(s) 131, 198
TspGWI ACGGA 1 cut(s) 135
VpaK11BI GGWCC 1 cut(s) 207
XspI CTAG 1 cut(s) 302
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.