Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co7998874.1

Orthogroup ID

OG0003404

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 525

Gene Structure 525 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co7998874.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 456 bp

gacaacggccccgactcgacccttttgctcagagagctcaactggctcgtagacgacgcagttcaacaaggaatcgaaaatggtcaaagaaaaattagattgagagtgagtctggaggagctgtacttgttgtggaagcagaggattgaagagaggaagccctttcagtacattgttgggtgcgagcattggagggagctggtgctgtgtgttcaagaaggggttttgattccgaggccggagactgagctcattgtggatttggtgggtgatgtggtgaagggtgaggagggtttaagagagggtttgtgggcagatttggggactgggagtggggctattgctattgggattgggagggttttggggactggtggtggcagagtcattgcaactgatttgagtcccactgcgatttcggttgcggggtttaatgtggagaggtatggtttgcag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

MTS Methyltransf_31 PrmA

Protein Analysis

152

Amino Acids

16.76

Weight (kDa)

4.78

Isoelectric Point (pI)

28.3

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003404)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G64150
fragaria_vesca	FvH4_3g16091
malus_domestica	MD05G1214000.v1.1 MD05G1214300.v1.1 MD10G1197800.v1.1
prunus_persica	Prupe.4G144100_v2.0.a1
pyrus_communis	pycom10g17050
rosa_chinensis	RchiOBHm_Chr5g0027061 RchiOBHm_Chr6g0281451
rosa_laevigata	RLG00000009431 RLG00000032986
rosa_multiflora	Rmu_co7998874.1_g000001 Rmu_sc0000847.1_g000007 Rmu_sc0000882.1_g000023 Rmu_sc0001866.1_g000008 Rmu_sc0006065.1_g000029
rosa_roxburghii	Rroxscaffold_1G00052430 Rroxscaffold_2G00135560 Rroxscaffold_6G00430700
rosa_rugosa	Rorug02G0601800 Rorug05G0096900 Rorug05G0097000
rosa_samantha	Rh1CG018500 Rh1DG015600 Rh3AG054200 Rh3BG055600 Rh3CG054900 Rh4BG038500 Rh5AG190600 Rh5BG188200 Rh5CG208000 Rh5DG190000 Rh5DG541600 Rh6BG255900 Rh6DG247400
rosa_wichuraiana	Rw5G017360

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	51
AciI	CCGC	1 cut(s)	425
AfaI	GTAC	2 cut(s)	125, 170
AgsI	TTSAA	3 cut(s)	65, 149, 215
AluBI	AGCT	4 cut(s)	37, 121, 199, 250
AluI	AGCT	4 cut(s)	37, 121, 199, 250
Alw21I	GWGCWC	2 cut(s)	39, 252
Alw26I	GTCTC	1 cut(s)	236
AoxI	GGCC	2 cut(s)	7, 236
AspS9I	GGNCC	1 cut(s)	8
AsuHPI	GGTGA	3 cut(s)	281, 289, 296
BanII	GRGCYC	2 cut(s)	39, 252
Bbv12I	GWGCWC	2 cut(s)	39, 252
BceAI	ACGGC	1 cut(s)	22
BcgI	CGANNNNNNTGC	2 cut(s)	7, 41
BcoDI	GTCTC	1 cut(s)	236
BmgT120I	GGNCC	1 cut(s)	8
BmiI	GGNNCC	1 cut(s)	10
BmrI	ACTGGG	1 cut(s)	336
BmuI	ACTGGG	1 cut(s)	336
BpmI	CTGGAG	1 cut(s)	134
BsaJI	CCNNGG	1 cut(s)	233
BsaXI	ACNNNNNCTCC	2 cut(s)	107, 137
Bse1I	ACTGG	3 cut(s)	47, 331, 376
Bse3DI	GCAATG	1 cut(s)	387
BseDI	CCNNGG	1 cut(s)	233
BseMI	GCAATG	1 cut(s)	387
BseMII	CTCAG	2 cut(s)	43, 237
BseNI	ACTGG	3 cut(s)	47, 331, 376
BseRI	GAGGAG	2 cut(s)	131, 302
BshFI	GGCC	2 cut(s)	9, 238
BsiHKAI	GWGCWC	2 cut(s)	39, 252
BsiSI	CCGG	1 cut(s)	239
BslFI	GGGAC	3 cut(s)	337, 382, 390
BsmAI	GTCTC	1 cut(s)	236
BsmFI	GGGAC	3 cut(s)	337, 382, 390
BsnI	GGCC	2 cut(s)	9, 238
Bsp1286I	GDGCHC	2 cut(s)	39, 252
BspACI	CCGC	1 cut(s)	425
BspANI	GGCC	2 cut(s)	9, 238
BspCNI	CTCAG	2 cut(s)	42, 238
BspLI	GGNNCC	1 cut(s)	10
BsrDI	GCAATG	1 cut(s)	387
BsrI	ACTGG	3 cut(s)	47, 331, 376
BssECI	CCNNGG	1 cut(s)	233
Bst6I	CTCTTC	1 cut(s)	144
BstC8I	GCNNGC	1 cut(s)	185
BstDEI	CTNAG	2 cut(s)	29, 246
BstMAI	GTCTC	1 cut(s)	236
BstMWI	GCNNNNNNNGC	2 cut(s)	34, 43
BsuRI	GGCC	2 cut(s)	9, 238
BtsI	GCAGTG	1 cut(s)	408
BtsIMutI	CAGTG	1 cut(s)	408
Cac8I	GCNNGC	1 cut(s)	185
Cfr13I	GGNCC	1 cut(s)	8
CseI	GACGC	1 cut(s)	65
Csp6I	GTAC	2 cut(s)	124, 169
CviJI	RGCY	9 cut(s)	9, 37, 46, 121, 160, 199, 238, 250, 338
CviKI_1	RGCY	9 cut(s)	9, 37, 46, 121, 160, 199, 238, 250, 338
CviQI	GTAC	2 cut(s)	124, 169
DdeI	CTNAG	2 cut(s)	29, 246
Eam1104I	CTCTTC	1 cut(s)	144
EarI	CTCTTC	1 cut(s)	144
Ecl136II	GAGCTC	2 cut(s)	37, 250
Eco24I	GRGCYC	2 cut(s)	39, 252
Eco53kI	GAGCTC	2 cut(s)	37, 250
EcoICRI	GAGCTC	2 cut(s)	37, 250
EcoT38I	GRGCYC	2 cut(s)	39, 252
FaiI	YATR	1 cut(s)	447
FaqI	GGGAC	3 cut(s)	337, 382, 390
FauI	CCCGC	1 cut(s)	418
FblI	GTMKAC	1 cut(s)	51
FriOI	GRGCYC	2 cut(s)	39, 252
GsuI	CTGGAG	1 cut(s)	134
HaeIII	GGCC	2 cut(s)	9, 238
HapII	CCGG	1 cut(s)	239
HgaI	GACGC	1 cut(s)	65
HinfI	GANTC	6 cut(s)	14, 72, 109, 229, 384, 403
HpaII	CCGG	1 cut(s)	239
HphI	GGTGA	3 cut(s)	281, 289, 296
Hpy166II	GTNNAC	1 cut(s)	52
Hpy188I	TCNGA	2 cut(s)	32, 234
Hpy188III	TCNNGA	2 cut(s)	113, 215
Hpy8I	GTNNAC	1 cut(s)	52
Hpy99I	CGWCG	1 cut(s)	59
HpyAV	CCTTC	2 cut(s)	212, 274
HpyCH4V	TGCA	2 cut(s)	392, 454
HpyF10VI	GCNNNNNNNGC	2 cut(s)	34, 43
HpyF3I	CTNAG	2 cut(s)	29, 246
LmnI	GCTCC	2 cut(s)	118, 196
LpnPI	CCDG	6 cut(s)	28, 98, 185, 252, 312, 357
MboII	GAAGA	1 cut(s)	161
MhlI	GDGCHC	2 cut(s)	39, 252
MluCI	AATT	1 cut(s)	93
MlyI	GAGTC	4 cut(s)	8, 118, 393, 412
MseI	TTAA	2 cut(s)	296, 432
MspI	CCGG	1 cut(s)	239
MwoI	GCNNNNNNNGC	2 cut(s)	34, 43
NlaIV	GGNNCC	1 cut(s)	10
PfeI	GAWTC	2 cut(s)	72, 229
PleI	GAGTC	4 cut(s)	8, 117, 392, 411
PpsI	GAGTC	4 cut(s)	8, 117, 392, 411
Psp124BI	GAGCTC	2 cut(s)	39, 252
PspN4I	GGNNCC	1 cut(s)	10
PspPI	GGNCC	1 cut(s)	8
RsaI	GTAC	2 cut(s)	125, 170
RsaNI	GTAC	2 cut(s)	124, 169
SacI	GAGCTC	2 cut(s)	39, 252
SaqAI	TTAA	2 cut(s)	296, 432
Sau96I	GGNCC	1 cut(s)	8
SchI	GAGTC	4 cut(s)	8, 118, 393, 412
SduI	GDGCHC	2 cut(s)	39, 252
SetI	ASST	5 cut(s)	39, 123, 201, 252, 446
Sse9I	AATT	1 cut(s)	93
SsiI	CCGC	1 cut(s)	425
SstI	GAGCTC	2 cut(s)	39, 252
TaqI	TCGA	2 cut(s)	17, 75
TasI	AATT	1 cut(s)	93
TatI	WGTACW	2 cut(s)	123, 168
TfiI	GAWTC	2 cut(s)	72, 229
Tru1I	TTAA	2 cut(s)	296, 432
Tru9I	TTAA	2 cut(s)	296, 432
TscAI	CASTG	1 cut(s)	415
TspRI	CASTG	1 cut(s)	415
XmiI	GTMKAC	1 cut(s)	51

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.