Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8202706.1

Orthogroup ID

OG0002827

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 683

Gene Structure 682 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8202706.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 468 bp

ctgggaacaaattacgggcatggtgcaaattttgccaccggaggatcaaccattagaaggccgaatgagaccattttcgagtatggcataagccccttttcgcttgatatgcagacggctcagttcctgcagttcaaagctcgaacagctgatctatttcgacaagccaagaatccctctgatagaagcaaacttccaaatcctcaagactttgcaaaggcactctatacgtttgatattgggcaaaatgatctctctgttggttttcgaaagctaagctttgatcagcttcgtgcagaaattccagacattgtaaaccagctggccacagcagtccgacgtatatatgaacaaggggggagggcattttggatacacaacacaggtccgattggttgtttgccagtgaatctgttctacaatcttaatcccgcaccaggttatgtagacgaacatggctgtgtcaag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005618 GO:0005623 GO:0005911 GO:0009505 GO:0009506 GO:0030054 GO:0030312 GO:0044464 GO:0055044 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Lipase_GDSL

Protein Analysis

156

Amino Acids

17.42

Weight (kDa)

8.62

Isoelectric Point (pI)

32.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002827)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G14450
fragaria_vesca	FvH4_6g51890 FvH4_6g51890 FvH4_6g51900 FvH4_6g51910 FvH4_6g51910 FvH4_6g51910
malus_domestica	MD09G1021800.v1.1 MD09G1021900.v1.1 MD09G1022200.v1.1 MD17G1021700.v1.1
prunus_persica	Prupe.3G294400_v2.0.a1 Prupe.3G294400_v2.0.a1 Prupe.3G294500_v2.0.a1 Prupe.3G294500_v2.0.a1
pyrus_communis	pycom111g01820 pycom111g01830 pycom111g01860 pycom17g01880
rosa_chinensis	RchiOBHm_Chr2g0173381 RchiOBHm_Chr2g0173391
rosa_laevigata	RLG00000022184 RLG00000022185
rosa_multiflora	Rmu_co8202706.1_g000001 Rmu_co8257229.1_g000001 Rmu_ssc0000282.1_g000010 Rmu_ssc0000282.1_g000011
rosa_roxburghii	Rroxscaffold_2G00078930 Rroxscaffold_2G00078940
rosa_rugosa	Rorug02G0567700 Rorug02G0567800
rosa_samantha	Rh2AG648300 Rh2AG648400 Rh2BG658900 Rh2BG659000 Rh2CG624200 Rh2CG624300
rosa_wichuraiana	Rw2G053210 Rw2G053220

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	447
AciI	CCGC	1 cut(s)	432
AclWI	GGATC	1 cut(s)	52
AcoI	YGGCCR	1 cut(s)	324
AcsI	RAATTY	2 cut(s)	28, 300
AfiI	CCNNNNNNNGG	2 cut(s)	57, 437
AgsI	TTSAA	1 cut(s)	136
AjnI	CCWGG	1 cut(s)	436
AluBI	AGCT	6 cut(s)	140, 149, 274, 279, 289, 322
AluI	AGCT	6 cut(s)	140, 149, 274, 279, 289, 322
Alw26I	GTCTC	1 cut(s)	62
AlwI	GGATC	1 cut(s)	52
AlwNI	CAGNNNCTG	1 cut(s)	127
AoxI	GGCC	2 cut(s)	59, 324
ApoI	RAATTY	2 cut(s)	28, 300
Asp700I	GAANNNNTTC	1 cut(s)	413
AspS9I	GGNCC	1 cut(s)	386
AsuII	TTCGAA	1 cut(s)	268
AvaII	GGWCC	1 cut(s)	386
BalI	TGGCCA	1 cut(s)	326
BceAI	ACGGC	1 cut(s)	132
BciT130I	CCWGG	1 cut(s)	438
BciVI	GTATCC	1 cut(s)	366
BclI	TGATCA	1 cut(s)	283
BcoDI	GTCTC	1 cut(s)	62
BfmI	CTRYAG	1 cut(s)	128
BfuI	GTATCC	1 cut(s)	366
BlpI	GCTNAGC	1 cut(s)	275
Bme1390I	CCNGG	1 cut(s)	438
Bme18I	GGWCC	1 cut(s)	386
BmgT120I	GGNCC	1 cut(s)	386
BmrFI	CCNGG	1 cut(s)	438
Bpu1102I	GCTNAGC	1 cut(s)	275
Bpu14I	TTCGAA	1 cut(s)	268
BpuEI	CTTGAG	1 cut(s)	189
BsaI	GGTCTC	1 cut(s)	62
BsaWI	WCCGGW	1 cut(s)	38
Bsc4I	CCNNNNNNNGG	2 cut(s)	57, 437
Bse1I	ACTGG	1 cut(s)	404
BseBI	CCWGG	1 cut(s)	438
BseLI	CCNNNNNNNGG	2 cut(s)	57, 437
BseMII	CTCAG	1 cut(s)	134
BseNI	ACTGG	1 cut(s)	404
BsgI	GTGCAG	1 cut(s)	315
BshFI	GGCC	2 cut(s)	61, 326
BsiSI	CCGG	1 cut(s)	39
BslI	CCNNNNNNNGG	2 cut(s)	57, 437
BsmAI	GTCTC	1 cut(s)	62
BsnI	GGCC	2 cut(s)	61, 326
Bso31I	GGTCTC	1 cut(s)	62
Bsp119I	TTCGAA	1 cut(s)	268
Bsp143I	GATC	4 cut(s)	44, 151, 250, 283
Bsp1720I	GCTNAGC	1 cut(s)	275
BspACI	CCGC	1 cut(s)	432
BspANI	GGCC	2 cut(s)	61, 326
BspCNI	CTCAG	1 cut(s)	133
BspMAI	CTGCAG	1 cut(s)	132
BspPI	GGATC	1 cut(s)	52
BspT104I	TTCGAA	1 cut(s)	268
BspTNI	GGTCTC	1 cut(s)	62
BsrI	ACTGG	1 cut(s)	404
BssMI	GATC	4 cut(s)	44, 151, 250, 283
Bst2UI	CCWGG	1 cut(s)	438
BstAPI	GCANNNNNTGC	1 cut(s)	32
BstBI	TTCGAA	1 cut(s)	268
BstC8I	GCNNGC	1 cut(s)	324
BstDEI	CTNAG	2 cut(s)	120, 275
BstKTI	GATC	4 cut(s)	47, 154, 253, 286
BstMAI	GTCTC	1 cut(s)	62
BstMBI	GATC	4 cut(s)	44, 151, 250, 283
BstMWI	GCNNNNNNNGC	3 cut(s)	32, 109, 146
BstNI	CCWGG	1 cut(s)	438
BstSCI	CCNGG	1 cut(s)	436
BstSFI	CTRYAG	1 cut(s)	128
BsuI	GTATCC	1 cut(s)	366
BsuRI	GGCC	2 cut(s)	61, 326
BtsIMutI	CAGTG	1 cut(s)	411
Cac8I	GCNNGC	1 cut(s)	324
CaiI	CAGNNNCTG	1 cut(s)	127
Cfr13I	GGNCC	1 cut(s)	386
CsiI	ACCWGGT	1 cut(s)	436
CviAII	CATG	2 cut(s)	20, 455
DdeI	CTNAG	2 cut(s)	120, 275
DpnI	GATC	4 cut(s)	46, 153, 252, 285
DpnII	GATC	4 cut(s)	44, 151, 250, 283
EaeI	YGGCCR	1 cut(s)	324
Eco31I	GGTCTC	1 cut(s)	62
Eco47I	GGWCC	1 cut(s)	386
EcoRII	CCWGG	1 cut(s)	436
FaeI	CATG	2 cut(s)	23, 458
FalI	AAGNNNNNCTT	2 cut(s)	263, 295
FatI	CATG	2 cut(s)	19, 454
FauI	CCCGC	1 cut(s)	439
FbaI	TGATCA	1 cut(s)	283
FblI	GTMKAC	1 cut(s)	447
HaeIII	GGCC	2 cut(s)	61, 326
HapII	CCGG	1 cut(s)	39
Hin1II	CATG	2 cut(s)	23, 458
HindIII	AAGCTT	1 cut(s)	277
HinfI	GANTC	2 cut(s)	172, 409
HpaII	CCGG	1 cut(s)	39
Hpy166II	GTNNAC	2 cut(s)	316, 448
Hpy188I	TCNGA	3 cut(s)	181, 338, 390
Hpy188III	TCNNGA	2 cut(s)	206, 305
Hpy8I	GTNNAC	2 cut(s)	316, 448
Hpy99I	CGWCG	1 cut(s)	342
HpyAV	CCTTC	1 cut(s)	51
HpyCH4IV	ACGT	2 cut(s)	230, 340
HpyCH4V	TGCA	5 cut(s)	26, 112, 130, 215, 296
HpyF10VI	GCNNNNNNNGC	3 cut(s)	32, 109, 146
HpyF3I	CTNAG	2 cut(s)	120, 275
HpySE526I	ACGT	2 cut(s)	230, 340
Hsp92II	CATG	2 cut(s)	23, 458
Ksp22I	TGATCA	1 cut(s)	283
Kzo9I	GATC	4 cut(s)	44, 151, 250, 283
LpnPI	CCDG	9 cut(s)	52, 140, 308, 318, 332, 369, 417, 423, 450
MabI	ACCWGGT	1 cut(s)	436
MaeII	ACGT	2 cut(s)	230, 340
MalI	GATC	4 cut(s)	46, 153, 252, 285
MboI	GATC	4 cut(s)	44, 151, 250, 283
MlsI	TGGCCA	1 cut(s)	326
MluCI	AATT	3 cut(s)	10, 28, 300
MluNI	TGGCCA	1 cut(s)	326
MmeI	TCCRAC	1 cut(s)	361
MnlI	CCTC	4 cut(s)	35, 187, 213, 354
Mox20I	TGGCCA	1 cut(s)	326
MroXI	GAANNNNTTC	1 cut(s)	413
MscI	TGGCCA	1 cut(s)	326
MseI	TTAA	1 cut(s)	426
MslI	CAYNNNNRTG	1 cut(s)	459
Msp20I	TGGCCA	1 cut(s)	326
MspA1I	CMGCKG	2 cut(s)	149, 322
MspI	CCGG	1 cut(s)	39
MspR9I	CCNGG	1 cut(s)	438
MvaI	CCWGG	1 cut(s)	438
MwoI	GCNNNNNNNGC	3 cut(s)	32, 109, 146
NdeII	GATC	4 cut(s)	44, 151, 250, 283
NlaIII	CATG	2 cut(s)	23, 458
NspV	TTCGAA	1 cut(s)	268
PdmI	GAANNNNTTC	1 cut(s)	413
PfeI	GAWTC	2 cut(s)	172, 409
Psp6I	CCWGG	1 cut(s)	436
PspGI	CCWGG	1 cut(s)	436
PspPI	GGNCC	1 cut(s)	386
PstI	CTGCAG	1 cut(s)	132
PstNI	CAGNNNCTG	1 cut(s)	127
PvuII	CAGCTG	2 cut(s)	149, 322
RseI	CAYNNNNRTG	1 cut(s)	459
SaqAI	TTAA	1 cut(s)	426
Sau3AI	GATC	4 cut(s)	44, 151, 250, 283
Sau96I	GGNCC	1 cut(s)	386
ScrFI	CCNGG	1 cut(s)	438
SexAI	ACCWGGT	1 cut(s)	436
SfcI	CTRYAG	1 cut(s)	128
SfuI	TTCGAA	1 cut(s)	268
SinI	GGWCC	1 cut(s)	386
SmiMI	CAYNNNNRTG	1 cut(s)	459
SmlI	CTYRAG	1 cut(s)	204
SmoI	CTYRAG	1 cut(s)	204
Sse9I	AATT	3 cut(s)	10, 28, 300
SsiI	CCGC	1 cut(s)	432
StyD4I	CCNGG	1 cut(s)	436
TaiI	ACGT	2 cut(s)	233, 343
TaqI	TCGA	4 cut(s)	78, 142, 160, 268
TasI	AATT	3 cut(s)	10, 28, 300
TfiI	GAWTC	2 cut(s)	172, 409
Tru1I	TTAA	1 cut(s)	426
Tru9I	TTAA	1 cut(s)	426
TscAI	CASTG	1 cut(s)	411
TspDTI	ATGAA	1 cut(s)	363
TspRI	CASTG	1 cut(s)	411
VpaK11BI	GGWCC	1 cut(s)	386
XapI	RAATTY	2 cut(s)	28, 300
XmiI	GTMKAC	1 cut(s)	447
XmnI	GAANNNNTTC	1 cut(s)	413

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.