Rmu_co8210356.1_g000001

Aldo-keto reductase family 4 member

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8210356.1
Physical Location & Seq
Reverse (-)
1 .. 641
641 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8210356.1_g000001.1.cds

Sequence Viewer

Length: 222 bp
atgcaggttgggtataggcatattgattgtgctcaaatttatggaaacgaaaaagagattggttgtgctctgaagaagctatatgatgatggtgtagtgaagcgtgaggacttgtggatcacttcaaaactctggtgtagtaatcatgcaccagaagatgtgccaaaggcactagatggcaccctgcaggacttgcaaagtgactatctcgatctgtacctg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.5

Weight (kDa)

4.71

Isoelectric Point (pI)

51.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 179
AclWI GGATC 1 cut(s) 125
AcsI RAATTY 1 cut(s) 36
AcuI CTGAAG 1 cut(s) 92
AfaI GTAC 1 cut(s) 218
AgsI TTSAA 1 cut(s) 126
AjuI GAANNNNNNNTTGG 2 cut(s) 42, 74
AluBI AGCT 1 cut(s) 79
AluI AGCT 1 cut(s) 79
Alw21I GWGCWC 2 cut(s) 34, 70
AlwI GGATC 1 cut(s) 125
ApoI RAATTY 1 cut(s) 36
BanI GGYRCC 1 cut(s) 179
Bbv12I GWGCWC 2 cut(s) 34, 70
BccI CCATC 2 cut(s) 83, 170
BfaI CTAG 1 cut(s) 173
BfmI CTRYAG 1 cut(s) 185
BmiI GGNNCC 1 cut(s) 181
BshNI GGYRCC 1 cut(s) 179
BsiHKAI GWGCWC 2 cut(s) 34, 70
Bsp1286I GDGCHC 2 cut(s) 34, 70
Bsp143I GATC 2 cut(s) 117, 211
BspLI GGNNCC 1 cut(s) 181
BspMAI CTGCAG 1 cut(s) 189
BspPI GGATC 1 cut(s) 125
BspT107I GGYRCC 1 cut(s) 179
BssMI GATC 2 cut(s) 117, 211
BstAPI GCANNNNNTGC 1 cut(s) 193
BstKTI GATC 2 cut(s) 120, 214
BstMBI GATC 2 cut(s) 117, 211
BstMWI GCNNNNNNNGC 1 cut(s) 193
BstSFI CTRYAG 1 cut(s) 185
Csp6I GTAC 1 cut(s) 217
CviAII CATG 1 cut(s) 146
CviJI RGCY 1 cut(s) 79
CviKI_1 RGCY 1 cut(s) 79
CviQI GTAC 1 cut(s) 217
DpnI GATC 2 cut(s) 119, 213
DpnII GATC 2 cut(s) 117, 211
Eco57I CTGAAG 1 cut(s) 92
FaeI CATG 1 cut(s) 149
FaiI YATR 6 cut(s) 15, 21, 42, 82, 84, 147
FatI CATG 1 cut(s) 145
FspBI CTAG 1 cut(s) 173
Hin1II CATG 1 cut(s) 149
Hpy188I TCNGA 1 cut(s) 72
Hpy188III TCNNGA 1 cut(s) 209
HpyCH4V TGCA 4 cut(s) 4, 149, 187, 196
HpyF10VI GCNNNNNNNGC 1 cut(s) 193
Hsp92II CATG 1 cut(s) 149
Kzo9I GATC 2 cut(s) 117, 211
LpnPI CCDG 4 cut(s) 118, 165, 173, 197
MaeI CTAG 1 cut(s) 173
MaeIII GTNAC 1 cut(s) 200
MalI GATC 2 cut(s) 119, 213
MboI GATC 2 cut(s) 117, 211
MboII GAAGA 2 cut(s) 85, 167
MhlI GDGCHC 2 cut(s) 34, 70
MluCI AATT 1 cut(s) 36
MnlI CCTC 1 cut(s) 100
MwoI GCNNNNNNNGC 1 cut(s) 193
NdeII GATC 2 cut(s) 117, 211
NlaIII CATG 1 cut(s) 149
NlaIV GGNNCC 1 cut(s) 181
NmuCI GTSAC 1 cut(s) 200
PspN4I GGNNCC 1 cut(s) 181
PstI CTGCAG 1 cut(s) 189
RsaI GTAC 1 cut(s) 218
RsaNI GTAC 1 cut(s) 217
Sau3AI GATC 2 cut(s) 117, 211
SbfI CCTGCAGG 1 cut(s) 189
SdaI CCTGCAGG 1 cut(s) 189
SduI GDGCHC 2 cut(s) 34, 70
SetI ASST 3 cut(s) 9, 81, 222
SfcI CTRYAG 1 cut(s) 185
Sse8387I CCTGCAGG 1 cut(s) 189
Sse9I AATT 1 cut(s) 36
SspMI CTAG 1 cut(s) 173
TaqI TCGA 1 cut(s) 210
TasI AATT 1 cut(s) 36
TseFI GTSAC 1 cut(s) 200
Tsp45I GTSAC 1 cut(s) 200
XapI RAATTY 1 cut(s) 36
XspI CTAG 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.