Rmu_sc0021566.1_g000001

Aldo-keto reductase family 4 member

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021566.1
Physical Location & Seq
Reverse (-)
2597 .. 3423
827 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021566.1_g000001.1.cds

Sequence Viewer

Length: 522 bp
atggaaactctctatgattcaagcaaggctcgagctattggtgtgagcaatttcgctacaaagaagctgtcagatttgctggatgtggcacgagttcctcctgctgttaaccaggtggagtgccatccttcgtggcagcaggccaagctgcgatcattctgcaaatccaagggggttcacctttctggatattcaccgctgggttctcctggcacaacatttatcaaaggcgatgtccttaagaatccgattcttctcagcgtggcagagaagctaggcaaaactcctgcacaggttgctcttcgatggggactgcaaatgggtcatagtgttcttccaaagagtactaatgaagcaaggatcaaggagaatctcgatgtctttggctggtctatcccagaagacttgtttgccaaattttctgaaattgagcaggaaaggctagtcaaagggaccttttttgtacatgacacttttggaccctatagaagtgtggaagaactctgggatggtgaaatctag

Protein Analysis

173

Amino Acids

19.2

Weight (kDa)

7.78

Isoelectric Point (pI)

47.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 197
AclWI GGATC 1 cut(s) 368
AcsI RAATTY 1 cut(s) 416
AfaI GTAC 2 cut(s) 346, 465
AflII CTTAAG 1 cut(s) 239
AgsI TTSAA 1 cut(s) 21
AjnI CCWGG 2 cut(s) 111, 208
AluBI AGCT 4 cut(s) 35, 67, 148, 274
AluI AGCT 4 cut(s) 35, 67, 148, 274
AlwI GGATC 1 cut(s) 368
Ama87I CYCGRG 1 cut(s) 30
AoxI GGCC 1 cut(s) 141
ApeKI GCWGC 2 cut(s) 136, 148
ApoI RAATTY 1 cut(s) 416
ArsI GACNNNNNNTTYG 4 cut(s) 53, 85, 219, 251
AspS9I GGNCC 2 cut(s) 453, 479
AsuHPI GGTGA 2 cut(s) 170, 186
AvaI CYCGRG 1 cut(s) 30
AvaII GGWCC 2 cut(s) 453, 479
BauI CACGAG 1 cut(s) 90
BbsI GAAGAC 1 cut(s) 408
BbvI GCAGC 2 cut(s) 135, 148
BccI CCATC 3 cut(s) 132, 300, 503
BcgI CGANNNNNNTGC 2 cut(s) 141, 175
BciT130I CCWGG 2 cut(s) 113, 210
BfaI CTAG 3 cut(s) 275, 443, 520
BfmI CTRYAG 1 cut(s) 484
BfrI CTTAAG 1 cut(s) 239
BisI GCNGC 2 cut(s) 137, 149
BlsI GCNGC 2 cut(s) 138, 150
BmcAI AGTACT 1 cut(s) 346
Bme1390I CCNGG 2 cut(s) 113, 210
Bme18I GGWCC 2 cut(s) 453, 479
BmeT110I CYCGRG 1 cut(s) 30
BmgT120I GGNCC 2 cut(s) 453, 479
BmiI GGNNCC 2 cut(s) 454, 481
BmrFI CCNGG 2 cut(s) 113, 210
BpiI GAAGAC 1 cut(s) 408
BsaJI CCNNGG 1 cut(s) 168
BseBI CCWGG 2 cut(s) 113, 210
BseDI CCNNGG 1 cut(s) 168
BseGI GGATG 3 cut(s) 88, 124, 514
BseMII CTCAG 1 cut(s) 271
BseXI GCAGC 2 cut(s) 135, 148
BseYI CCCAGC 1 cut(s) 199
BsgI GTGCAG 1 cut(s) 273
BshFI GGCC 1 cut(s) 143
BsiHKCI CYCGRG 1 cut(s) 30
BslFI GGGAC 2 cut(s) 324, 466
BsmFI GGGAC 2 cut(s) 324, 466
BsnI GGCC 1 cut(s) 143
BsoBI CYCGRG 1 cut(s) 30
Bsp1407I TGTACA 1 cut(s) 463
Bsp143I GATC 2 cut(s) 152, 360
BspACI CCGC 1 cut(s) 197
BspANI GGCC 1 cut(s) 143
BspCNI CTCAG 1 cut(s) 270
BspLI GGNNCC 2 cut(s) 454, 481
BspPI GGATC 1 cut(s) 368
BspQI GCTCTTC 1 cut(s) 306
BspTI CTTAAG 1 cut(s) 239
BsrGI TGTACA 1 cut(s) 463
BssECI CCNNGG 1 cut(s) 168
BssMI GATC 2 cut(s) 152, 360
BssSI CACGAG 1 cut(s) 90
BssT1I CCWWGG 1 cut(s) 168
Bst2BI CACGAG 1 cut(s) 90
Bst2UI CCWGG 2 cut(s) 113, 210
Bst6I CTCTTC 1 cut(s) 306
BstAFI CTTAAG 1 cut(s) 239
BstAPI GCANNNNNTGC 1 cut(s) 296
BstAUI TGTACA 1 cut(s) 463
BstC8I GCNNGC 1 cut(s) 141
BstDEI CTNAG 1 cut(s) 257
BstF5I GGATG 3 cut(s) 88, 124, 514
BstKTI GATC 2 cut(s) 155, 363
BstMBI GATC 2 cut(s) 152, 360
BstMWI GCNNNNNNNGC 3 cut(s) 145, 296, 439
BstNI CCWGG 2 cut(s) 113, 210
BstSCI CCNGG 2 cut(s) 111, 208
BstSFI CTRYAG 1 cut(s) 484
BstV1I GCAGC 2 cut(s) 135, 148
BstV2I GAAGAC 1 cut(s) 408
BsuRI GGCC 1 cut(s) 143
BtgZI GCGATG 1 cut(s) 246
BtsCI GGATG 3 cut(s) 88, 124, 514
Cac8I GCNNGC 1 cut(s) 141
Cfr13I GGNCC 2 cut(s) 453, 479
CsiI ACCWGGT 1 cut(s) 111
Csp6I GTAC 2 cut(s) 345, 464
CviAII CATG 1 cut(s) 467
CviJI RGCY 8 cut(s) 29, 35, 67, 143, 148, 274, 387, 442
CviKI_1 RGCY 8 cut(s) 29, 35, 67, 143, 148, 274, 387, 442
CviQI GTAC 2 cut(s) 345, 464
DdeI CTNAG 1 cut(s) 257
DpnI GATC 2 cut(s) 154, 362
DpnII GATC 2 cut(s) 152, 360
Eam1104I CTCTTC 1 cut(s) 306
EarI CTCTTC 1 cut(s) 306
Eco130I CCWWGG 1 cut(s) 168
Eco47I GGWCC 2 cut(s) 453, 479
Eco88I CYCGRG 1 cut(s) 30
EcoO109I RGGNCCY 1 cut(s) 453
EcoRII CCWGG 2 cut(s) 111, 208
EcoT14I CCWWGG 1 cut(s) 168
ErhI CCWWGG 1 cut(s) 168
FaeI CATG 1 cut(s) 470
FaiI YATR 4 cut(s) 15, 327, 468, 486
FaqI GGGAC 2 cut(s) 324, 466
FatI CATG 1 cut(s) 466
Fnu4HI GCNGC 2 cut(s) 137, 149
FokI GGATG 2 cut(s) 95, 111
Fsp4HI GCNGC 2 cut(s) 137, 149
FspBI CTAG 3 cut(s) 275, 443, 520
GluI GCNGC 2 cut(s) 137, 149
GsaI CCCAGC 1 cut(s) 203
HaeIII GGCC 1 cut(s) 143
Hin1II CATG 1 cut(s) 470
HincII GTYRAC 1 cut(s) 109
HindII GTYRAC 1 cut(s) 109
HinfI GANTC 4 cut(s) 17, 244, 250, 370
HpaI GTTAAC 1 cut(s) 109
HphI GGTGA 2 cut(s) 170, 186
Hpy166II GTNNAC 2 cut(s) 109, 178
Hpy188I TCNGA 3 cut(s) 73, 249, 424
Hpy188III TCNNGA 2 cut(s) 186, 374
Hpy8I GTNNAC 2 cut(s) 109, 178
HpyAV CCTTC 1 cut(s) 138
HpyCH4V TGCA 3 cut(s) 162, 290, 316
HpyF10VI GCNNNNNNNGC 3 cut(s) 145, 296, 439
HpyF3I CTNAG 1 cut(s) 257
Hsp92II CATG 1 cut(s) 470
KspAI GTTAAC 1 cut(s) 109
Kzo9I GATC 2 cut(s) 152, 360
LguI GCTCTTC 1 cut(s) 306
Lsp1109I GCAGC 2 cut(s) 135, 148
MabI ACCWGGT 1 cut(s) 111
MaeI CTAG 3 cut(s) 275, 443, 520
MalI GATC 2 cut(s) 154, 362
MboI GATC 2 cut(s) 152, 360
MboII GAAGA 5 cut(s) 245, 293, 326, 413, 509
MluCI AATT 3 cut(s) 49, 416, 426
MnlI CCTC 1 cut(s) 108
MseI TTAA 2 cut(s) 108, 240
MspA1I CMGCKG 1 cut(s) 199
MspCI CTTAAG 1 cut(s) 239
MspR9I CCNGG 2 cut(s) 113, 210
MvaI CCWGG 2 cut(s) 113, 210
MwoI GCNNNNNNNGC 3 cut(s) 145, 296, 439
NdeII GATC 2 cut(s) 152, 360
NlaIII CATG 1 cut(s) 470
NlaIV GGNNCC 2 cut(s) 454, 481
PaeR7I CTCGAG 1 cut(s) 30
PciSI GCTCTTC 1 cut(s) 306
PfeI GAWTC 4 cut(s) 17, 244, 250, 370
PkrI GCNGC 2 cut(s) 138, 150
PpuMI RGGWCCY 1 cut(s) 453
Psp5II RGGWCCY 1 cut(s) 453
Psp6I CCWGG 2 cut(s) 111, 208
PspFI CCCAGC 1 cut(s) 199
PspGI CCWGG 2 cut(s) 111, 208
PspN4I GGNNCC 2 cut(s) 454, 481
PspPI GGNCC 2 cut(s) 453, 479
PspPPI RGGWCCY 1 cut(s) 453
PspXI VCTCGAGB 1 cut(s) 30
RsaI GTAC 2 cut(s) 346, 465
RsaNI GTAC 2 cut(s) 345, 464
SapI GCTCTTC 1 cut(s) 306
SaqAI TTAA 2 cut(s) 108, 240
SatI GCNGC 2 cut(s) 137, 149
Sau3AI GATC 2 cut(s) 152, 360
Sau96I GGNCC 2 cut(s) 453, 479
ScaI AGTACT 1 cut(s) 346
ScrFI CCNGG 2 cut(s) 113, 210
SetI ASST 8 cut(s) 37, 69, 117, 150, 183, 276, 297, 458
SexAI ACCWGGT 1 cut(s) 111
SfcI CTRYAG 1 cut(s) 484
Sfr274I CTCGAG 1 cut(s) 30
SinI GGWCC 2 cut(s) 453, 479
SlaI CTCGAG 1 cut(s) 30
SmlI CTYRAG 2 cut(s) 30, 239
SmoI CTYRAG 2 cut(s) 30, 239
Sse9I AATT 3 cut(s) 49, 416, 426
SsiI CCGC 1 cut(s) 197
SspMI CTAG 3 cut(s) 275, 443, 520
StyD4I CCNGG 2 cut(s) 111, 208
StyI CCWWGG 1 cut(s) 168
TaqI TCGA 3 cut(s) 31, 304, 375
TasI AATT 3 cut(s) 49, 416, 426
TatI WGTACW 2 cut(s) 344, 463
TfiI GAWTC 4 cut(s) 17, 244, 250, 370
Tru1I TTAA 2 cut(s) 108, 240
Tru9I TTAA 2 cut(s) 108, 240
TseI GCWGC 2 cut(s) 136, 148
TspDTI ATGAA 1 cut(s) 366
Vha464I CTTAAG 1 cut(s) 239
VpaK11BI GGWCC 2 cut(s) 453, 479
XapI RAATTY 1 cut(s) 416
XhoI CTCGAG 1 cut(s) 30
XspI CTAG 3 cut(s) 275, 443, 520
ZrmI AGTACT 1 cut(s) 346
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.