Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8245821.1

Orthogroup ID

OG0004848

Physical Location & Seq

Genomic Coordinates Reverse (-)

38 .. 781

Gene Structure 744 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8245821.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 744 bp

acttcattccctatcttcccctaccaagatagggaagaagacgaggaagaagaggagggagaggaagagaaagaggaaaaggaagacgaagtggaaaaggaaaacgaagaagaggaagacgaggaggagaacgacgatgatcgtgatcttatcatatggaatccttctactcaagatacatacaagttacccaaaatcaaaataatttgtcgccacgacttttatggatttggttatgattgcaccaatgaagattacaaggttataacaggctttaacaaccgtgaaagtgaaagtgactgtgaaactgaaattagggcttccaatcccccaacagccacacttgcattctttacattaaaaacaggttcatggaagatagttaaaaatctctacaccgtcggaaagtgctatgggccggggcgcttattgaacggagctctaccttggctagaggacagctacagctatttaagattcacaatcatctcttttgatctagccgtggagaaatttcaagctttattgccaccacccgatatttgcacgacagaacgcaccatccacctcgaaattgggacgactattgggaactcactcttcctgtatctttacgattgggggtgtcatgaattgcaaacaggtattgcaataacaatatgggtgatgaaagaatatggggttaatgaatcctggactagagtggttcagattccttcttttaagtttatctccgcatcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box FBA_1

Protein Analysis

247

Amino Acids

28.71

Weight (kDa)

4.32

Isoelectric Point (pI)

45.68

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004848)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g18082 FvH4_6g43211
malus_domestica	MD09G1135400.v1.1 MD17G1131100.v1.1
prunus_persica	Prupe.3G191300_v2.0.a1
pyrus_communis	pycom420g00950
rosa_chinensis	RchiOBHm_Chr5g0030151 RchiOBHm_Chr7g0203691
rosa_laevigata	RLG00000005803 RLG00000022101
rosa_multiflora	Rmu_co8245821.1_g000001 Rmu_sc0001707.1_g000011 Rmu_sc0005354.1_g000006 Rmu_sc0005969.1_g000041 Rmu_sc0038336.1_g000001
rosa_roxburghii	Rroxscaffold_1G00049840 Rroxscaffold_1G00049860 Rroxscaffold_2G00093700 Rroxscaffold_2G00093750 Rroxscaffold_2G00095980 Rroxscaffold_2G00096010 Rroxscaffold_6G00426490
rosa_rugosa	Rorug02G0430700 Rorug02G0447100 Rorug02G0558400 Rorug02G0610800 Rorug05G0117300
rosa_samantha	Rh2AG633400 Rh2BG647000
rosa_wichuraiana	Rw5G019160 Rw5G019190

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	266
AciI	CCGC	1 cut(s)	735
AcsI	RAATTY	1 cut(s)	512
AfiI	CCNNNNNNNGG	1 cut(s)	31
AgsI	TTSAA	2 cut(s)	433, 518
AjnI	CCWGG	1 cut(s)	692
AloI	GAACNNNNNNTCC	2 cut(s)	546, 578
AluBI	AGCT	4 cut(s)	440, 462, 468, 521
AluI	AGCT	4 cut(s)	440, 462, 468, 521
Alw21I	GWGCWC	1 cut(s)	442
AoxI	GGCC	1 cut(s)	416
ApoI	RAATTY	1 cut(s)	512
AspLEI	GCGC	1 cut(s)	426
AspS9I	GGNCC	1 cut(s)	416
AsuC2I	CCSGG	1 cut(s)	420
AsuHPI	GGTGA	1 cut(s)	676
BanII	GRGCYC	1 cut(s)	442
BbsI	GAAGAC	3 cut(s)	45, 90, 123
Bbv12I	GWGCWC	1 cut(s)	442
BccI	CCATC	1 cut(s)	569
BceAI	ACGGC	1 cut(s)	488
BciT130I	CCWGG	1 cut(s)	694
BcnI	CCSGG	1 cut(s)	420
BfaI	CTAG	3 cut(s)	452, 500, 699
BfmI	CTRYAG	1 cut(s)	463
BfoI	RGCGCY	1 cut(s)	427
Bme1390I	CCNGG	2 cut(s)	420, 694
BmgT120I	GGNCC	1 cut(s)	416
BmrFI	CCNGG	2 cut(s)	420, 694
BpiI	GAAGAC	3 cut(s)	45, 90, 123
BpuEI	CTTGAG	1 cut(s)	156
BpuMI	CCSGG	1 cut(s)	420
BsaBI	GATNNNNATC	1 cut(s)	144
BsaJI	CCNNGG	3 cut(s)	419, 446, 504
Bsc4I	CCNNNNNNNGG	1 cut(s)	31
Bse8I	GATNNNNATC	1 cut(s)	144
BseBI	CCWGG	1 cut(s)	694
BseDI	CCNNGG	3 cut(s)	419, 446, 504
BseGI	GGATG	1 cut(s)	561
BseJI	GATNNNNATC	1 cut(s)	144
BseLI	CCNNNNNNNGG	1 cut(s)	31
BseRI	GAGGAG	3 cut(s)	68, 137, 140
BshFI	GGCC	1 cut(s)	418
BsiHKAI	GWGCWC	1 cut(s)	442
BsiSI	CCGG	1 cut(s)	419
BslFI	GGGAC	1 cut(s)	592
BslI	CCNNNNNNNGG	1 cut(s)	31
BsmFI	GGGAC	1 cut(s)	592
BsmI	GAATGC	1 cut(s)	347
BsnI	GGCC	1 cut(s)	418
Bsp1286I	GDGCHC	1 cut(s)	442
Bsp143I	GATC	3 cut(s)	139, 145, 496
BspACI	CCGC	1 cut(s)	735
BspANI	GGCC	1 cut(s)	418
BspHI	TCATGA	1 cut(s)	628
BssECI	CCNNGG	3 cut(s)	419, 446, 504
BssMI	GATC	3 cut(s)	139, 145, 496
BssT1I	CCWWGG	1 cut(s)	446
Bst2UI	CCWGG	1 cut(s)	694
Bst4CI	ACNGT	3 cut(s)	284, 302, 400
Bst6I	CTCTTC	4 cut(s)	45, 60, 105, 605
BstDSI	CCRYGG	1 cut(s)	504
BstF5I	GGATG	1 cut(s)	561
BstH2I	RGCGCY	1 cut(s)	427
BstHHI	GCGC	1 cut(s)	426
BstKTI	GATC	3 cut(s)	142, 148, 499
BstMBI	GATC	3 cut(s)	139, 145, 496
BstMWI	GCNNNNNNNGC	1 cut(s)	344
BstNI	CCWGG	1 cut(s)	694
BstSCI	CCNGG	2 cut(s)	418, 692
BstSFI	CTRYAG	1 cut(s)	463
BstV2I	GAAGAC	3 cut(s)	45, 90, 123
BsuRI	GGCC	1 cut(s)	418
BtgI	CCRYGG	1 cut(s)	504
BtsCI	GGATG	1 cut(s)	561
CciI	TCATGA	1 cut(s)	628
CfoI	GCGC	1 cut(s)	426
Cfr13I	GGNCC	1 cut(s)	416
CviAII	CATG	2 cut(s)	372, 629
DpnI	GATC	3 cut(s)	141, 147, 498
DpnII	GATC	3 cut(s)	139, 145, 496
Eam1104I	CTCTTC	4 cut(s)	45, 60, 105, 605
EarI	CTCTTC	4 cut(s)	45, 60, 105, 605
Ecl136II	GAGCTC	1 cut(s)	440
Eco130I	CCWWGG	1 cut(s)	446
Eco24I	GRGCYC	1 cut(s)	442
Eco53kI	GAGCTC	1 cut(s)	440
EcoICRI	GAGCTC	1 cut(s)	440
EcoRII	CCWGG	1 cut(s)	692
EcoT14I	CCWWGG	1 cut(s)	446
EcoT38I	GRGCYC	1 cut(s)	442
ErhI	CCWWGG	1 cut(s)	446
FaeI	CATG	2 cut(s)	375, 632
FaqI	GGGAC	1 cut(s)	592
FatI	CATG	2 cut(s)	371, 628
FauNDI	CATATG	1 cut(s)	155
FokI	GGATG	1 cut(s)	548
FriOI	GRGCYC	1 cut(s)	442
FspBI	CTAG	3 cut(s)	452, 500, 699
GlaI	GCGC	1 cut(s)	425
HaeII	RGCGCY	1 cut(s)	427
HaeIII	GGCC	1 cut(s)	418
HapII	CCGG	1 cut(s)	419
HhaI	GCGC	1 cut(s)	426
Hin1II	CATG	2 cut(s)	375, 632
Hin6I	GCGC	1 cut(s)	424
HinP1I	GCGC	1 cut(s)	424
HindIII	AAGCTT	1 cut(s)	519
HinfI	GANTC	4 cut(s)	160, 477, 689, 712
HpaII	CCGG	1 cut(s)	419
HphI	GGTGA	1 cut(s)	676
Hpy188I	TCNGA	2 cut(s)	404, 711
Hpy188III	TCNNGA	4 cut(s)	143, 173, 629, 741
Hpy99I	CGWCG	2 cut(s)	137, 404
HpyAV	CCTTC	2 cut(s)	174, 726
HpyCH4III	ACNGT	3 cut(s)	284, 302, 400
HpyCH4V	TGCA	5 cut(s)	243, 347, 546, 637, 650
HpyF10VI	GCNNNNNNNGC	1 cut(s)	344
Hsp92II	CATG	2 cut(s)	375, 632
HspAI	GCGC	1 cut(s)	424
Kzo9I	GATC	3 cut(s)	139, 145, 496
LmnI	GCTCC	1 cut(s)	437
LpnPI	CCDG	7 cut(s)	255, 351, 432, 617, 627, 679, 706
MaeI	CTAG	3 cut(s)	452, 500, 699
MaeIII	GTNAC	2 cut(s)	186, 296
MalI	GATC	3 cut(s)	141, 147, 498
MboI	GATC	3 cut(s)	139, 145, 496
MhlI	GDGCHC	1 cut(s)	442
MluCI	AATT	5 cut(s)	204, 312, 512, 573, 632
MmeI	TCCRAC	1 cut(s)	382
MseI	TTAA	6 cut(s)	276, 359, 384, 473, 684, 723
MspI	CCGG	1 cut(s)	419
MspR9I	CCNGG	2 cut(s)	420, 694
Mva1269I	GAATGC	1 cut(s)	347
MvaI	CCWGG	1 cut(s)	694
MwoI	GCNNNNNNNGC	1 cut(s)	344
NciI	CCSGG	1 cut(s)	420
NdeI	CATATG	1 cut(s)	155
NdeII	GATC	3 cut(s)	139, 145, 496
NlaIII	CATG	2 cut(s)	375, 632
NmuCI	GTSAC	1 cut(s)	296
PagI	TCATGA	1 cut(s)	628
PctI	GAATGC	1 cut(s)	347
PfeI	GAWTC	4 cut(s)	160, 477, 689, 712
PfoI	TCCNGGA	1 cut(s)	692
PsiI	TTATAA	1 cut(s)	266
Psp124BI	GAGCTC	1 cut(s)	442
Psp6I	CCWGG	1 cut(s)	692
PspGI	CCWGG	1 cut(s)	692
PspPI	GGNCC	1 cut(s)	416
SacI	GAGCTC	1 cut(s)	442
SaqAI	TTAA	6 cut(s)	276, 359, 384, 473, 684, 723
Sau3AI	GATC	3 cut(s)	139, 145, 496
Sau96I	GGNCC	1 cut(s)	416
ScrFI	CCNGG	2 cut(s)	420, 694
SduI	GDGCHC	1 cut(s)	442
SetI	ASST	9 cut(s)	264, 370, 442, 448, 464, 470, 523, 570, 646
SfcI	CTRYAG	1 cut(s)	463
SmlI	CTYRAG	1 cut(s)	171
SmoI	CTYRAG	1 cut(s)	171
Sse9I	AATT	5 cut(s)	204, 312, 512, 573, 632
SsiI	CCGC	1 cut(s)	735
SspMI	CTAG	3 cut(s)	452, 500, 699
SstI	GAGCTC	1 cut(s)	442
StyD4I	CCNGG	2 cut(s)	418, 692
StyI	CCWWGG	1 cut(s)	446
TaaI	ACNGT	3 cut(s)	284, 302, 400
TaqI	TCGA	1 cut(s)	570
TasI	AATT	5 cut(s)	204, 312, 512, 573, 632
TfiI	GAWTC	4 cut(s)	160, 477, 689, 712
Tru1I	TTAA	6 cut(s)	276, 359, 384, 473, 684, 723
Tru9I	TTAA	6 cut(s)	276, 359, 384, 473, 684, 723
TseFI	GTSAC	1 cut(s)	296
Tsp45I	GTSAC	1 cut(s)	296
TspDTI	ATGAA	5 cut(s)	264, 360, 645, 683, 702
TspGWI	ACGGA	1 cut(s)	450
XapI	RAATTY	1 cut(s)	512
XcmI	CCANNNNNNNNNTGG	2 cut(s)	221, 572
XspI	CTAG	3 cut(s)	452, 500, 699

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.